LncRNA Gene

ZFLNCG03477

Basic Information

Chromesome: chr5

Start: 50062486

End: 50062766

Transcript: ZFLNCT05330

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023146 head kidney normal 13.55
SRR891510 muscle normal 13.37
SRR1648856 brain normal 10.50
ERR145648 skeletal muscle 27 degree_C to 27 degree_C 8.05
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 6.19
ERR145631 skeletal muscle 32 degree_C to 16 degree_C 5.60
SRR038624 embryo traf6 morpholino and bacterial infection 5.49
SRR038627 embryo control morpholino 4.84
ERR145635 skeletal muscle 27 degree_C to 16 degree_C 4.67
SRR516126 skin male and 5 month 3.56
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG03477
GCTATTTCTGGCGGGACAGCAACATTTAGGAAGTGTGGGCCACGGGCCAGCGAGCAGTTTAATGACACGC
CTGCGTCACATGGTCTCTTGTCACAGGAGCTCCCGCCATTGTCAGGGTTGAGCGCGGGCACGCACACACA
AGGTTATTTGTTTTTCCAATGGGGCCTTAAGAGAGCAGCTGCAGGTGAAAGGAGCCCCCTCTGCAATTCA
CCATAGAAAACACAGCAGTCCACGGCCTGTCCTGTGCTGCACTGGCCAGCAAACCCTAAAGTTTCAAATA