LncRNA Gene

ZFLNCG03554

Basic Information

Chromesome: chr5

Start: 62740942

End: 62741146

Transcript: ZFLNCT05467

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1647684 spleen SVCV treatment 62.48
SRR1048061 pineal gland dark 41.19
SRR1647681 head kidney SVCV treatment 30.62
SRR516123 skin male and 3.5 year 27.68
SRR1647683 spleen SVCV treatment 19.78
SRR1205160 5dpf transgenic sqET20 and GFP+ 13.93
SRR516132 skin male and 5 month 13.87
SRR801555 embryo RPS19 morpholino 13.46
SRR891495 heart normal 10.68
SRR941749 anterior pectoral fin normal 10.68
Express in tissues
Correlated coding gene Download
gene correlation coefficent
ftr64 0.54
rnf115 0.54
irf2 0.51
parp16 0.51
pex7 0.51
tmem173 0.50
Gene Ontology Download
GO P value
GO:0032606 3.55e-04
GO:0032481 3.55e-04
GO:0002230 3.55e-04
GO:0032479 7.11e-04
GO:0039528 7.11e-04
GO:0098586 7.11e-04
GO:0050691 7.11e-04
GO:0002753 7.11e-04
GO:0001816 1.07e-03
GO:0050688 1.78e-03
GO:0003950 7.09e-03
GO:0016763 1.66e-02
GO:0061630 3.30e-02
GO:0061659 3.30e-02
GO:0008270 3.69e-02
KEGG Pathway Download
KO P value
ko04623 1.13e-02
ko04622 1.71e-02
ko04146 2.46e-02
ko04621 4.31e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG03554
TTAAACTTCACGCACCTCTCAGCTGCTGTAGATTAGGAGTGTATGTGGATCACAGAGCAGGAACTCTGTC
TTTCTACAGCGTGTCTGACACATCAATGAGCCTCATCCACACCGAACAGACCACATTCACTCAGCCGCTC
TATCCTGGGTTTTTACTTGCTTTCGGATCGACTATAAAGCTGCTGTGAAAAGAAGAGTACAAAA