LncRNA Gene

ZFLNCG03580

Basic Information

Chromesome: chr5

Start: 65057609

End: 65057854

Transcript: ZFLNCT05508

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516132 skin male and 5 month 30.27
SRR891510 muscle normal 28.88
SRR516127 skin male and 5 month 15.67
ERR023145 heart normal 12.98
SRR516131 skin male and 5 month 12.61
SRR516133 skin male and 5 month 8.24
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 8.11
SRR516126 skin male and 5 month 7.90
SRR516128 skin male and 5 month 7.90
SRR516125 skin male and 3.5 year 7.11
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-197m14.2 0.57
LOC797398 0.55
si:dkey-21e2.12 0.55
LOC100000903 0.51
LOC101884711 0.51
si:dkey-78l4.6 0.51
ftr11 0.50
si:ch211-149o7.4 0.50
LOC100005081 0.50
LOC100329837 0.50
Gene Ontology Download
GO P value
GO:0006508 4.44e-03
GO:0004252 1.98e-04
GO:0017171 2.76e-04
GO:0008236 2.76e-04
GO:0004175 1.43e-03
GO:0070011 2.85e-03
GO:0008233 3.09e-03
GO:0016787 4.01e-02
KEGG Pathway Download
KO P value
ko04144 6.53e-03
ko05332 7.48e-03
ko05330 9.96e-03
ko05320 1.20e-02
ko04940 1.33e-02
ko05416 2.27e-02
ko04650 3.98e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG03580
CCTCCTCAACCGCCCTGCTCCCCTGTCCGCTGTTTACTTTCACTTTCTTCCGCGACTCCCTAACGCTTCA
CTTTTTGTCCGTGACACCCCTCCGCCATCCGCCGCACCAGTCCGCGCGGCACCTCTTCATCCTCGGGTAA
CATGCCGGTGCCGTAATCCCGATCTGTTCCGGGACCTCGCAATTCACAAATTAAGCACTGCGCACACCCT
AATGTGACATGGAAGTCAAGGGGGATCAAAGTAGT