LncRNA Gene

ZFLNCG04444

Basic Information

Chromesome: chr7

Start: 21496779

End: 21496985

Transcript: ZFLNCT06835

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR957181 heart normal 47.27
SRR957180 heart 7 days after heart tip amputation 47.10
ERR023145 heart normal 46.08
ERR145631 skeletal muscle 32 degree_C to 16 degree_C 28.14
SRR516122 skin male and 3.5 year 27.04
SRR1039573 gastrointestinal diet 0.75 NPM 15.86
ERR145635 skeletal muscle 27 degree_C to 16 degree_C 15.64
SRR800045 muscle normal 12.40
SRR516127 skin male and 5 month 11.87
ERR023144 brain normal 10.55
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG04444
AACAAAATCTACTGATTGAAAGGAACCTGTTTTTCTAGGGAGGTTTAAAGATGAGCAGTAAAGACCAGGA
AGATGGCGCCACCCAGTGTCTGAAAGCTCAGAGGTCTAGGAGGAGAAACGGGATCACATGAATCATCATC
ACATCATTTTTGTGACACTGTACAATGATTAACATTTTTACATTAGTGTGAGCGTTGGGGTAAGCA