LncRNA Gene

ZFLNCG04536

Basic Information

Chromesome: chr7

Start: 28819206

End: 28819441

Transcript: ZFLNCT06983

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR891504 liver normal 28.93
ERR023146 head kidney normal 10.92
SRR1035239 liver transgenic mCherry control 5.03
SRR372802 5 dpf normal 2.97
SRR516122 skin male and 3.5 year 2.54
SRR1188148 embryo Control PBS 0.5 hpi 2.38
SRR594771 endothelium normal 2.33
SRR1291414 5 dpi normal 1.97
SRR535849 larvae normal 1.84
SRR1188156 embryo Control PBS 4 hpi 1.84
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG04536
CTAGATACATTGTTCTCCATGAAATAAAAAGCTGACATTATTTTCTGTCCCCTTATGCCTTTACCAAAGG
CAAGTCTAAAATAAAACAAATAACTAGCTTAGGTTACCTCATGTACTTCATTCCAAAACCTCTAAAGCCA
CAGGATAACTTTCTGTGAGAAACAGTCCACATTCAATCATTATTCACTGATAATGAAGATAAGCTGCAGC
ACAGTTTAGGATTAGCAGTGCACTA