LncRNA Gene

ZFLNCG04643

Basic Information

Chromesome: chr7

Start: 40864071

End: 40864312

Transcript: ZFLNCT07153

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1205160 5dpf transgenic sqET20 and GFP+ 40.51
SRR1205169 5dpf transgenic sqET20 and neomycin treated 5h and GFP+ 36.01
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 35.45
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 33.57
SRR726542 5 dpf infection with control 10.61
SRR726541 5 dpf infection with Mycobacterium marinum 10.55
SRR038624 embryo traf6 morpholino and bacterial infection 9.97
SRR527832 16-36 hpf normal 8.34
SRR527834 head normal 6.58
SRR038625 embryo traf6 morpholino 5.93
Express in tissues
Correlated coding gene Download
gene correlation coefficent
zgc:110716 0.53
v-fbpl 0.53
nr5a1a 0.52
cldnj 0.51
Gene Ontology Download
GO P value
GO:0031174 6.39e-04
GO:0045299 8.53e-04
GO:0009888 1.47e-03
GO:0030325 1.92e-03
GO:0021854 2.13e-03
GO:0031214 3.19e-03
GO:0031018 5.32e-03
GO:0043401 1.61e-02
GO:0009755 1.76e-02
GO:0045944 2.81e-02
GO:0090575 7.44e-03
GO:0044798 8.72e-03
GO:0005923 1.04e-02
GO:0070160 1.06e-02
GO:0005667 2.41e-02
GO:0005911 2.89e-02
GO:0004879 1.06e-02
GO:0098531 1.06e-02
GO:0003707 1.65e-02
GO:0003682 2.28e-02
GO:0000976 2.62e-02
GO:1990837 2.75e-02
GO:0003690 3.27e-02
GO:0044212 3.71e-02
GO:0000975 4.04e-02
GO:0001067 4.04e-02
KEGG Pathway Download
KO P value
ko04514 1.80e-02
ko04670 2.10e-02
ko05160 2.12e-02
ko04530 3.16e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG04643
CGTGCCACAGCAGCTGCTGGGGTCTTTAGGTGGGATATATATCTGGTTCTGTTGGATAGATAGCACAGTT
AAGTTAGTAGGTGTTTTGTGCTTGACTTCTGAGTGTCTTTGTTCATGTGTTATACTCACAGGCTGGCAGC
GTGCAGTGCAGTTAGTGCCAGTGGATCTGAGGACGTAGAAACCAGTGGCTGAGTCTAGTGTGTGTGTGCA
CTGTGTGGCGTAACACACACCCTGATCCCGG