LncRNA Gene

ZFLNCG04758

Basic Information

Chromesome: chr7

Start: 59146537

End: 59146829

Transcript: ZFLNCT07348

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023145 heart normal 74.96
SRR957181 heart normal 45.99
SRR957180 heart 7 days after heart tip amputation 28.38
ERR145635 skeletal muscle 27 degree_C to 16 degree_C 26.12
SRR592703 pineal gland normal 24.17
SRR891495 heart normal 24.13
SRR592701 pineal gland normal 20.91
ERR145631 skeletal muscle 32 degree_C to 16 degree_C 16.34
SRR1562531 muscle normal 14.52
ERR023144 brain normal 10.99
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC101883980 0.65
abcc9 0.64
si:ch211-157b11.14 0.63
prnprs3 0.63
si:dkey-257h21.2 0.63
plekha7b 0.63
foxo3b 0.62
LOC101884005 0.62
eef2l2 0.62
impa2 0.62
Gene Ontology Download
GO P value
GO:0031175 9.59e-05
GO:0007010 2.30e-04
GO:0007015 3.92e-04
GO:0090527 6.90e-04
GO:0015980 1.53e-03
GO:0006091 1.90e-03
GO:0050808 2.13e-03
GO:0060914 2.25e-03
GO:0006073 2.42e-03
GO:0044042 2.42e-03
GO:0031463 3.81e-04
GO:0016012 1.37e-03
GO:0005964 1.37e-03
GO:0031461 3.80e-03
GO:0000151 5.20e-03
GO:0030427 7.79e-03
GO:0005874 9.48e-03
GO:0045202 1.19e-02
GO:0099513 1.52e-02
GO:0099512 1.52e-02
GO:0004683 7.76e-06
GO:0005516 3.38e-04
GO:0008017 3.92e-04
GO:0015631 1.07e-03
GO:0004689 1.37e-03
GO:0004842 3.20e-03
GO:0019787 3.91e-03
GO:0008066 5.62e-03
GO:0005085 9.48e-03
GO:0017080 9.64e-03
KEGG Pathway Download
KO P value
ko04713 1.62e-06
ko04724 4.84e-06
ko04728 3.13e-05
ko04922 4.68e-05
ko04261 8.01e-05
ko04725 2.60e-04
ko04921 4.35e-04
ko04371 5.49e-04
ko04740 6.49e-04
ko04745 1.54e-03
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG04758
CACCTTGTGTATATGCAATCTTGATATGTTTGGTCTTGGTGGCATACTGTAGATCTGCTACTGATTAAAT
TATTGGTGCAAAGCAAGTATTGAGACTTGCTACAGTCAGTATATTCACATTGTCAGAAAAAACAGTTTAA
CACTCTGCCATTGCAAACATAACATACAGTAAATATAACCGTCATTGCAGATCTAAGCATAGGTGGAGTT
GGGGCTGAAGAGGGACAGAAAGTTGCAGATTGCTAGTGCAAATGACACTGAGGTACTCTAATGTTGAAGA
GCAAGCTCATTT