LncRNA Gene

ZFLNCG04780

Basic Information

Chromesome: chr7

Start: 62867510

End: 62867729

Transcript: ZFLNCT07374

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR372802 5 dpf normal 12.24
ERR023145 heart normal 8.75
SRR891495 heart normal 7.88
SRR1028003 head normal 5.54
SRR1342216 embryo norml 4.49
SRR516127 skin male and 5 month 4.47
SRR726541 5 dpf infection with Mycobacterium marinum 4.11
SRR941749 anterior pectoral fin normal 2.77
SRR749515 24 hpf eif3ha morphant 2.68
SRR516126 skin male and 5 month 2.50
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG04780
ATGTGTCCAGGTGAAAAACATCCCAGAAGTAAGAAGCAGCCTTGACTAGGTTCTTTGAAGTGCACAACAG
CTGTGAAAAGTCTCATGCGCTGATAAGGACAGACTCTGTGTCACAGTGTACAAACAGCACGGCTGCGTTT
ACACACAAGATAAAGATAGACTGTGTACTTTCCTAAGAAAGCTACATAAGAATGTTACATGGGCACAACT
TGGGACATT