LncRNA Gene

ZFLNCG05154

Basic Information

Chromesome: chr8

Start: 23355790

End: 23355996

Transcript: ZFLNCT07994

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1049946 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with DMSO 9.53
SRR886457 512 cell 4-thio-UTP metabolic labeling 8.17
SRR1028003 head normal 5.53
SRR891495 heart normal 2.65
SRR1562530 liver normal 2.09
SRR038625 embryo traf6 morpholino 2.01
SRR658541 6 somite normal 1.81
SRR065196 3 dpf normal 1.69
SRR038626 embryo control morpholino and bacterial infection 1.68
SRR1523214 embryo glut12 morpholino 1.58
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG05154
ATCTGCTGGATTTTTGACTGCAGCTTTGAATCCTGGATCACCTTACGAAGGCCATCCAATGTGCGTTTGT
TTATGATTAGTCTCTCTTTCTGCTGATCACTCGCCACAGTCGGTTTTGTTTTTTGCAAGCAAATTTGGAT
ATAAGAGGTGATGCCAAACTCTTTTCTCAGTTCACGGTCACTCTTGGGCTGATGACTTGGAGTGGG