LncRNA Gene

ZFLNCG05353

Basic Information

Chromesome: chr8

Start: 45033787

End: 45034047

Transcript: ZFLNCT08277

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023143 swim bladder normal 525.66
ERR023146 head kidney normal 264.22
ERR023145 heart normal 241.56
SRR1299124 caudal fin Zero day time after treatment 176.18
SRR1299129 caudal fin Seven days time after treatment 131.38
ERR023144 brain normal 122.63
SRR1299127 caudal fin Two days time after treatment 114.86
SRR1299126 caudal fin One day time after treatment 113.80
SRR1299125 caudal fin Half day time after treatment 103.78
SRR516131 skin male and 5 month 86.30
Express in tissues
Correlated coding gene Download
gene correlation coefficent
crfb2 0.63
zgc:73185 0.61
LOC101885539 0.58
sirt2 0.58
gltpd1 0.58
si:dkey-52k20.13 0.57
ufm1 0.57
ccr10 0.57
lgalsla 0.57
LOC100334281 0.56
Gene Ontology Download
GO P value
GO:0007034 2.47e-03
GO:0061433 2.56e-03
GO:2000378 2.56e-03
GO:1990592 2.56e-03
GO:2000777 2.56e-03
GO:0006771 2.56e-03
GO:0009231 2.56e-03
GO:1990564 2.56e-03
GO:1900119 2.56e-03
GO:0070446 2.56e-03
GO:0044224 2.56e-03
GO:0072687 2.56e-03
GO:0005720 2.56e-03
GO:0097386 2.56e-03
GO:0043020 2.56e-03
GO:0033010 2.56e-03
GO:0043220 2.56e-03
GO:0016020 3.93e-03
GO:0033185 5.11e-03
GO:0033270 5.11e-03
GO:0004904 6.36e-06
GO:0034739 2.56e-03
GO:0042903 2.56e-03
GO:0008531 2.56e-03
GO:0046970 2.56e-03
GO:0004896 4.22e-03
GO:0034876 1.02e-02
GO:0043909 1.02e-02
GO:0052790 1.02e-02
GO:0034781 1.02e-02
KEGG Pathway Download
KO P value
ko04215 7.34e-03
ko05166 7.65e-03
ko04217 1.24e-02
ko04214 1.67e-02
ko04721 2.03e-02
ko00740 2.20e-02
ko04211 4.49e-02
ko01522 4.56e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG05353
TTTGATTGGATATTTTTGTTAACTAGACTGTTTTCATATTGTATTTTTCTAACATTACTTCCTGTTCATG
TTAGTAGTACAAATTTAGAAAGTGGTGCAATGCACTGAAACTATTATAAATATATGAATATAAATCTCTA
TAGAGTGCAGAATGTGCTATATTCTTGGACCAGCCATTGCAGCTCCTGTTAGTAGAAACAGCAGATATTG
TTTTGTTCCATGTTCCTAAAGATGTTTAATAAGATGTTTCTGAGCAAATC