LncRNA Gene

ZFLNCG05361

Basic Information

Chromesome: chr8

Start: 46319921

End: 46320221

Transcript: ZFLNCT08289

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR800043 sphere stage normal 18.59
SRR800049 sphere stage control treatment 16.21
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 14.00
SRR886457 512 cell 4-thio-UTP metabolic labeling 12.67
SRR800046 sphere stage 5azaCyD treatment 11.53
SRR1205169 5dpf transgenic sqET20 and neomycin treated 5h and GFP+ 9.30
SRR800037 egg normal 8.38
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 8.32
SRR516130 skin male and 5 month 6.98
SRR1021213 sphere stage normal 6.44
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG05361
CGGGATGTCTCCCACAAAGATGAACACTTGGGACAAAAGCACCAACTCAGCCAACCGCATAGATCTGTCA
GCAGTATAATACATTCAGATCCAAAAGAGCGCAGGAGGACAACAGCACAGCGCTTCCTGTAGAAAAACAC
GTGCCTTGCAGTATTGCATCGTAAACAGACTCCAAATGATGAAATAGTTACTTGCAGCTAATTGTAGAAT
AGTGCACTCACAACACAAAGTTCTCTGATGTCATTTCCTCCTGCTGATGATCTCTTTATTGTGAACTGGT
TGAAGACACAAGGCCCGTTG