LncRNA Gene

ZFLNCG05483

Basic Information

Chromesome: chr9

Start: 40714

End: 40971

Transcript: ZFLNCT08478

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR941753 posterior pectoral fin normal 39.81
SRR941749 anterior pectoral fin normal 38.73
SRR527834 head normal 35.67
SRR1048059 pineal gland light 24.19
SRR1299124 caudal fin Zero day time after treatment 22.63
SRR1205160 5dpf transgenic sqET20 and GFP+ 21.68
SRR1028004 head normal 16.18
SRR516126 skin male and 5 month 14.02
SRR516134 skin male and 5 month 12.32
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 11.01
Express in tissues
Correlated coding gene Download
gene correlation coefficent
scel 0.60
LOC561520 0.59
fam129aa 0.59
si:ch73-52f15.5 0.59
LOC560512 0.58
crfb12 0.58
zgc:158773 0.58
b4galnt3a 0.57
crfb16 0.57
si:dkey-221j11.3 0.57
Gene Ontology Download
GO P value
GO:0009987 3.51e-05
GO:0008152 9.96e-05
GO:0044237 2.09e-04
GO:0008150 4.53e-04
GO:0006807 9.49e-04
GO:0044260 1.47e-03
GO:0043170 1.57e-03
GO:0008544 1.64e-03
GO:0034641 1.98e-03
GO:1902578 2.02e-03
GO:0005911 3.37e-08
GO:0030054 1.30e-06
GO:0005923 2.10e-05
GO:0070160 2.32e-05
GO:0030057 6.93e-04
GO:0016021 1.33e-03
GO:0005922 1.36e-03
GO:0031224 1.39e-03
GO:0005921 2.25e-03
GO:0044425 2.66e-03
GO:0004859 1.45e-07
GO:0055102 1.45e-07
GO:0005544 2.13e-04
GO:0004896 2.25e-03
GO:0003824 2.56e-03
GO:0005198 4.70e-03
GO:0008116 6.89e-03
GO:0030368 1.37e-02
GO:0016595 1.37e-02
GO:0005173 1.37e-02
KEGG Pathway Download
KO P value
ko04514 1.10e-02
ko00590 1.49e-02
ko04640 2.20e-02
ko04060 3.05e-02
ko04730 3.18e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG05483
TCGACAATACCTGTCCTCTCAGAGAAACAGGGGCACAGACAGTAATGGAGTAAACCTCTTACAGGAGGCT
CGTCTTCATACAGCACACCTAATCATGATGTATTTACAGTAAACTAGCACATATTACAGCCTACACTGCT
GGAACACACGTCAACAGCTGGACCAACCGGTTTATACACTGAGAGAAAGAGAAAGTGTGAAAATGAGAAG
ACTCTGCGGAGTGTTGAATCTGTTCATCTGTCTGATTTTATCCAGAT