LncRNA Gene

ZFLNCG05503

Basic Information

Chromesome: chr9

Start: 1107427

End: 1107631

Transcript: ZFLNCT08500

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023143 swim bladder normal 1199.05
ERR023145 heart normal 258.15
SRR592702 pineal gland normal 203.24
SRR592703 pineal gland normal 201.84
SRR372802 5 dpf normal 184.79
SRR957180 heart 7 days after heart tip amputation 178.89
SRR516127 skin male and 5 month 143.84
ERR023144 brain normal 137.41
SRR592701 pineal gland normal 124.86
SRR516128 skin male and 5 month 121.69
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC100003048 0.60
cst3 0.59
gpr1 0.59
syap1 0.58
LOC101882276 0.56
itm2ba 0.56
mgp 0.55
cryabb 0.55
LOC793369 0.55
bco2l 0.54
Gene Ontology Download
GO P value
GO:0060973 9.87e-04
GO:2000378 2.35e-03
GO:2000472 2.35e-03
GO:2000471 2.35e-03
GO:0048842 2.35e-03
GO:2000777 2.35e-03
GO:0003147 2.35e-03
GO:0061433 2.35e-03
GO:1900119 2.35e-03
GO:0080058 2.35e-03
GO:0044224 2.35e-03
GO:0072687 2.35e-03
GO:0005720 2.35e-03
GO:0097386 2.35e-03
GO:0033010 2.35e-03
GO:0043220 2.35e-03
GO:0044425 4.37e-03
GO:0005576 4.54e-03
GO:0033185 4.68e-03
GO:0033270 4.68e-03
GO:0018741 2.35e-03
GO:0034739 2.35e-03
GO:0034902 2.35e-03
GO:0047045 2.35e-03
GO:0034889 2.35e-03
GO:0042903 2.35e-03
GO:0004944 2.35e-03
GO:0004942 2.35e-03
GO:0010436 2.35e-03
GO:0010437 2.35e-03
KEGG Pathway Download
KO P value
ko00140 1.38e-03
ko04060 1.92e-03
ko05202 2.65e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG05503
TTGAATTTCAAGTCATGTGAAGCCATACGATGTCTTTATATGAAGAACGGAGTGATTTATGAGTCTCTAA
AAGCTGAAAATGGCTTGCTAATTTCCTCTAATTAAAAAAAAAATAGCTGAAGTATATTAGCATGATGCAA
TTAGTTACGAGACACAAAGAGAGCCAATAGCATTCGACAACTGAAGAGGATGTAAGACGCTGGC