LncRNA Gene

ZFLNCG05508

Basic Information

Chromesome: chr9

Start: 1348560

End: 1348913

Transcript: ZFLNCT08506

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 38.13
SRR1299129 caudal fin Seven days time after treatment 20.22
ERR023143 swim bladder normal 19.80
ERR023146 head kidney normal 16.86
ERR023145 heart normal 16.17
SRR1299125 caudal fin Half day time after treatment 15.24
SRR516124 skin male and 3.5 year 15.00
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 14.06
SRR516133 skin male and 5 month 13.97
SRR592701 pineal gland normal 13.87
Express in tissues
Correlated coding gene Download
gene correlation coefficent
tec 0.65
zgc:123258 0.62
LOC101886535 0.62
nfkbiaa 0.60
crfb4 0.60
snx10b 0.60
LOC100001405 0.59
slc43a3b 0.58
tnfb 0.58
il4r.1 0.58
Gene Ontology Download
GO P value
GO:0006952 6.24e-07
GO:0002682 7.88e-07
GO:0002683 3.49e-06
GO:0050776 3.53e-06
GO:0051707 5.04e-06
GO:0002376 6.30e-06
GO:0051704 7.27e-06
GO:0043207 2.24e-05
GO:0009607 2.71e-05
GO:0009617 3.96e-05
GO:0044424 4.52e-04
GO:0044422 5.59e-04
GO:0044446 8.26e-04
GO:0044425 3.86e-03
GO:0016020 4.44e-03
GO:0043234 5.62e-03
GO:0043020 6.40e-03
GO:0016021 6.67e-03
GO:0043226 7.21e-03
GO:0031224 9.19e-03
GO:0004896 1.82e-03
GO:0019979 6.40e-03
GO:0003692 6.40e-03
GO:0003726 1.28e-02
GO:0046934 1.28e-02
GO:0004197 1.36e-02
GO:0050700 1.91e-02
GO:0008745 1.91e-02
GO:0042056 1.91e-02
GO:0052813 1.91e-02
KEGG Pathway Download
KO P value
ko05167 1.57e-08
ko04668 3.90e-08
ko04380 1.02e-07
ko05160 3.20e-07
ko04621 3.98e-07
ko04217 1.15e-06
ko04060 2.08e-06
ko05145 1.10e-05
ko04210 1.27e-05
ko05168 1.38e-05
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG05508
GTGGATATGTGCTGAATGCATCTAATAGGAGGCAGTGCCATATATTTGTATTGAGAACAGAATCCTGAGG
TTCTGATGTCCAAAACTAATTAGTCATCAGTTATTTTTTTTTAAATGTATTTTTGTACTGAGCCTCTAGA
CGAGAATATTTGAGTGTGTGTGAAATCTACATGCTTGATCAAAATGTGAAAGTGTCGACTCCTGCATTTA
CTTCAGTGGGACTCGCTCTGTGAATGAACTCTTTTCCCGCCATGCAGCATTTTTGATGATGTCACTATAA
CATGACGGCCCTCAGGTTATGTTCTGCTATAGGAATAAATGACCGTGTTATATATCACAATAAAGGATCA
AGC