LncRNA Gene

ZFLNCG05959

Basic Information

Chromesome: chr9

Start: 44106249

End: 44106489

Transcript: ZFLNCT09182

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023145 heart normal 343.05
SRR516122 skin male and 3.5 year 126.13
SRR1562531 muscle normal 83.39
SRR800045 muscle normal 67.25
ERR023146 head kidney normal 58.57
SRR516133 skin male and 5 month 55.62
SRR1708346 embryo SIBPS 39.95
SRR372802 5 dpf normal 37.89
SRR776510 embryo Salmonella infected and miR-146 knockdown 37.51
SRR535978 larvae normal 37.35
Express in tissues
Correlated coding gene Download
gene correlation coefficent
ttnb 0.79
ttna 0.75
tnnt3b 0.69
smyhc1 0.68
pvalb2 0.68
mylpfa 0.68
tpma 0.68
neb 0.67
ckma 0.67
LOC100333825 0.67
Gene Ontology Download
GO P value
GO:0003009 2.35e-12
GO:0006936 6.91e-12
GO:0031032 7.93e-12
GO:0003012 8.87e-12
GO:0030036 3.63e-11
GO:0045214 3.76e-11
GO:0006941 3.76e-11
GO:0030029 5.42e-11
GO:0003008 3.24e-09
GO:0060048 3.25e-09
GO:0005861 2.35e-12
GO:0044449 3.50e-11
GO:0031430 8.10e-09
GO:0033017 9.22e-09
GO:0016529 1.83e-08
GO:0044430 5.12e-07
GO:0016459 1.37e-05
GO:0036379 2.94e-05
GO:0005865 2.94e-05
GO:0044853 6.95e-05
GO:0003779 5.24e-08
GO:0005509 8.04e-08
GO:0008307 8.64e-07
GO:0008092 1.41e-05
GO:0042805 9.14e-05
GO:0051371 9.14e-05
GO:0097493 9.14e-05
GO:0051393 9.14e-05
GO:0003676 2.93e-04
GO:0005261 6.43e-04
KEGG Pathway Download
KO P value
ko05410 8.89e-17
ko04260 1.84e-15
ko05414 1.45e-14
ko04261 8.85e-12
ko05412 1.82e-08
ko04020 2.00e-06
ko05416 1.00e-04
ko04510 1.88e-04
ko04921 3.85e-04
ko04022 4.80e-04
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG05959
ACTGACCTACAATTTTATCCCAAAATAAACAAGAAAATTGAGAATACATCAAACAAAGACAATCATCACA
TTGTCCTTTAATCTAAAATATTTAATTTTCACTTTTATTTACAACCTATTAAATCTTTAACCCACTTTCC
ACTAATTTAGAAAAACAAGATCAAACTATACAACACAAATGTTAATTAACACGCCGCTGCTTTACTAATC
CTTTAAATATGAACTTGGGCAAGAAAAATC