LncRNA Gene

ZFLNCG06219

Basic Information

Chromesome: chr10

Start: 15111284

End: 15111529

Transcript: ZFLNCT09563

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516133 skin male and 5 month 73.77
SRR1562531 muscle normal 33.66
SRR1299124 caudal fin Zero day time after treatment 33.12
SRR516131 skin male and 5 month 26.14
SRR1299127 caudal fin Two days time after treatment 22.58
SRR516128 skin male and 5 month 19.33
SRR1299126 caudal fin One day time after treatment 11.08
SRR1299125 caudal fin Half day time after treatment 9.86
SRR1299128 caudal fin Three days time after treatment 8.73
SRR527834 head normal 7.20
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06219
ATTTATTGAGTATTGCACATTTGTACAATTTGTGCAACATAGAAATTCCACATGTACTGGCTCTTTTCCA
CATCACTTTGCTATACTCACACTAGTTGACACCATCTTGGAAATAGAGATATTGTGTTTGTTTGATTAAT
CTGGCTGAAGGAATCAGATATATGTTGCTCTAAATATTTTTTTTGGGGGGGAAATGAGTTTGCAATACTA
AATACAGTGGAGAAAACAAACAGGAATAGGTGAAT