LncRNA Gene

ZFLNCG06305

Basic Information

Chromesome: chr10

Start: 22287905

End: 22288130

Transcript: ZFLNCT09692

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR891512 blood normal 106.43
SRR516133 skin male and 5 month 50.41
SRR941753 posterior pectoral fin normal 29.92
SRR516124 skin male and 3.5 year 29.81
SRR1049946 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with DMSO 29.50
SRR516121 skin male and 3.5 year 23.03
SRR372802 5 dpf normal 22.31
SRR516123 skin male and 3.5 year 18.80
SRR1205160 5dpf transgenic sqET20 and GFP+ 17.79
SRR516134 skin male and 5 month 16.83
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-7c18.24 0.66
ponzr10 0.66
avil 0.62
si:dkey-11o15.5 0.62
zgc:136767 0.61
si:dkeyp-75b4.8 0.61
wu:fk35f04 0.61
si:busm1-71b9.3 0.61
krt15 0.60
si:dkey-211g8.7 0.60
Gene Ontology Download
GO P value
GO:0046483 3.63e-05
GO:0034641 4.69e-05
GO:0006139 8.10e-05
GO:0072676 9.69e-05
GO:0048247 9.69e-05
GO:1901576 1.18e-04
GO:0090304 1.43e-04
GO:0044237 1.66e-04
GO:0044260 1.94e-04
GO:0006807 2.12e-04
GO:0044424 6.56e-06
GO:0005578 4.17e-04
GO:0044422 4.37e-04
GO:0044464 4.39e-04
GO:0044446 6.23e-04
GO:0044421 8.42e-04
GO:0031012 9.74e-04
GO:0043229 1.13e-03
GO:0044428 1.34e-03
GO:0016021 1.65e-03
GO:0004252 1.42e-04
GO:0017171 3.99e-04
GO:0008236 3.99e-04
GO:0005488 2.06e-03
GO:0004175 3.66e-03
GO:0000981 4.81e-03
GO:0003674 7.88e-03
GO:0004411 9.88e-03
GO:0048020 9.88e-03
GO:0004964 9.88e-03
KEGG Pathway Download
KO P value
ko04672 9.74e-05
ko04060 1.56e-03
ko04974 3.68e-03
ko04658 3.68e-03
ko05164 4.82e-03
ko04657 1.99e-02
ko00350 2.01e-02
ko05150 2.37e-02
ko04064 2.57e-02
ko00643 2.64e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06305
GACTGAGTGCAGAGGATGTTTATTGACAAATGTGACAATGTAATAGGGGTTAGGTGCAGAACAGTTCAAT
GGTGAATGTATTGGGTAGTGCTGGTGAATCCCGGATAATGCAGCCAGAATCCAAGTAATGCCGGAAGGGT
AGGAGACTGAGCAGTGGGCAGGGTTGGACAAAAACAAAGAACAGAGACAAGGCACACAGAACAGACAGGG
GGAACAAAACAAAAC