LncRNA Gene

ZFLNCG06337

Basic Information

Chromesome: chr10

Start: 24928083

End: 24928314

Transcript: ZFLNCT09730

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023145 heart normal 504.38
ERR023143 swim bladder normal 312.30
SRR516131 skin male and 5 month 115.66
ERR023146 head kidney normal 90.40
SRR516134 skin male and 5 month 86.67
SRR516122 skin male and 3.5 year 65.20
ERR145631 skeletal muscle 32 degree_C to 16 degree_C 60.12
SRR516133 skin male and 5 month 59.39
ERR145635 skeletal muscle 27 degree_C to 16 degree_C 58.37
SRR1028004 head normal 53.65
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC101884393 0.66
tnmd 0.65
col4a1 0.65
popdc3 0.65
sema3c 0.64
kcnj2a 0.64
serpinf1 0.64
scn4ab 0.63
LOC100334893 0.63
zgc:110191 0.63
Gene Ontology Download
GO P value
GO:0003009 2.05e-07
GO:0006941 1.38e-06
GO:0060048 2.26e-06
GO:0044260 2.69e-06
GO:0090304 3.26e-06
GO:0006936 3.90e-06
GO:0003012 4.58e-06
GO:0019222 7.61e-06
GO:0009889 1.35e-05
GO:0031326 1.35e-05
GO:0031012 4.16e-11
GO:0043229 2.36e-10
GO:0043226 3.12e-10
GO:0005578 3.59e-10
GO:0043231 7.41e-09
GO:0043227 2.14e-08
GO:0005634 3.48e-08
GO:0044421 1.24e-07
GO:0005861 2.05e-07
GO:0044424 2.51e-07
GO:0003676 2.65e-06
GO:0005201 4.55e-06
GO:1901363 1.15e-04
GO:0005539 1.61e-04
GO:0097159 1.66e-04
GO:0008201 1.89e-04
GO:0015171 3.22e-04
GO:0008509 6.21e-04
GO:0004019 7.09e-04
GO:0005520 7.43e-04
KEGG Pathway Download
KO P value
ko04510 5.25e-12
ko04512 7.42e-12
ko04974 1.80e-08
ko04151 1.59e-05
ko05410 2.03e-04
ko04933 2.25e-04
ko04810 3.39e-04
ko04261 8.36e-04
ko04260 1.20e-03
ko05146 1.26e-03
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06337
TTTTATTTTCAAAATCCTTTCATTAATACTGTATAAAATTCAAAGAATGGCATTTATTAGAAAGATACTG
CTTTTTGTAACATTATTAATTGCTTTTAGCAATCTCATTCATCCTGGCTGAATAAAAGTATTACTTAAAT
AATATATTCTTTTATTACTGACCCCAGAACTTTTCAAGCACCACAAACAGCATATTGGAGTGATTTCTGA
ATGACCAGACTCAATAATGAC