LncRNA Gene

ZFLNCG06338

Basic Information

Chromesome: chr10

Start: 24928899

End: 24929154

Transcript: ZFLNCT09731

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023143 swim bladder normal 401.66
ERR023145 heart normal 298.73
ERR145631 skeletal muscle 32 degree_C to 16 degree_C 232.01
ERR145635 skeletal muscle 27 degree_C to 16 degree_C 225.07
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 166.21
SRR516131 skin male and 5 month 129.00
SRR516122 skin male and 3.5 year 119.26
SRR516133 skin male and 5 month 104.66
SRR1028002 head normal 91.88
ERR023146 head kidney normal 88.78
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC100329456 0.68
sema3c 0.66
popdc3 0.66
chad 0.66
LOC101884393 0.65
sgcg 0.65
scn4ab 0.65
si:ch211-225p5.8 0.64
tnmd 0.64
abi3bp 0.64
Gene Ontology Download
GO P value
GO:0003009 1.04e-08
GO:0090304 7.82e-08
GO:0060048 1.02e-07
GO:0006941 1.04e-07
GO:0044260 1.13e-07
GO:0016070 5.82e-07
GO:0044237 7.08e-06
GO:0006936 7.34e-06
GO:0003012 8.61e-06
GO:0046483 8.65e-06
GO:0005578 1.83e-11
GO:0031012 2.41e-11
GO:0043229 1.39e-10
GO:0043226 1.79e-10
GO:0044421 2.40e-09
GO:0043231 8.57e-09
GO:0005861 1.04e-08
GO:0043227 1.63e-08
GO:0044424 1.48e-07
GO:0005634 7.50e-07
GO:0003676 2.07e-06
GO:0005201 7.90e-06
GO:0097159 2.10e-05
GO:1901363 2.84e-05
GO:0004857 7.93e-05
GO:0005518 9.43e-05
GO:0005044 1.18e-04
GO:0038024 1.64e-04
GO:0008201 2.96e-04
GO:0005244 3.86e-04
KEGG Pathway Download
KO P value
ko04512 9.53e-13
ko04510 1.27e-09
ko04974 3.64e-08
ko05410 4.32e-05
ko04151 1.39e-04
ko05414 6.11e-04
ko04260 1.68e-03
ko04810 2.20e-03
ko04261 5.13e-03
ko05416 5.57e-03
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06338
TATATTTATTAGTTCTAGAAAAACGTCTTCATATATATTTTTATTTGTAGATATGCTGACGGTCCTGATG
AAGATGTACAATCAGTCAATGAATATTCTATCGTTCTTCGTTTATTCCATGAAGTAAATGATTTGTAAAT
AGCAAATGATGCTCTTTATTATGCAGAAAAAAGCAATAATGTTTGTGCAGAGGCCTTGTTTATTTTTTGG
TTAGATACATTTTAGTAGATTAAAATGTATTATTTTCATATATGT