LncRNA Gene

ZFLNCG06492

Basic Information

Chromesome: chr10

Start: 41336262

End: 41336503

Transcript: ZFLNCT09958

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1648854 brain normal 61.39
SRR1648856 brain normal 46.89
ERR023144 brain normal 23.66
SRR1049946 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with DMSO 18.11
SRR516135 skin male and 5 month 15.59
SRR1648855 brain normal 14.93
SRR1523211 embryo control morpholino 13.36
SRR038625 embryo traf6 morpholino 13.33
SRR1291414 5 dpi normal 13.12
SRR1205160 5dpf transgenic sqET20 and GFP+ 12.59
Express in tissues
Correlated coding gene Download
gene correlation coefficent
irx2a 0.56
LOC797951 0.55
mmp23bb 0.54
si:dkey-174e3.3 0.54
LOC100537430 0.53
bcl11ba 0.52
phkg1a 0.51
kal1a 0.51
fbrsl1 0.50
gpatch8 0.50
Gene Ontology Download
GO P value
GO:0005978 3.19e-03
GO:0009250 3.19e-03
GO:0033692 4.26e-03
GO:0034637 4.61e-03
GO:0000271 4.97e-03
GO:0006073 6.38e-03
GO:0044042 6.38e-03
GO:0005977 6.38e-03
GO:0006112 7.09e-03
GO:0044264 7.44e-03
GO:0005964 1.42e-03
GO:1902554 8.15e-03
GO:1902911 9.56e-03
GO:0061695 2.78e-02
GO:0004689 1.42e-03
GO:0004683 6.73e-03
GO:0005516 1.41e-02
GO:1901363 2.16e-02
GO:0097159 2.24e-02
GO:0004222 2.67e-02
GO:0043167 2.83e-02
GO:0003676 2.89e-02
GO:0005488 3.07e-02
GO:0008237 4.23e-02
KEGG Pathway Download
KO P value
ko04922 1.78e-02
ko04910 2.39e-02
ko04020 3.68e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06492
GTGTGCTACGGTACGGTACGAGTCGGTACTTTCAATAGGTACCAAAAAGCAAGTTACCATAGGTACTAAA
CCGTTACTGTTACTCCTGCTGTTCTATTGACGCTCCCCTGCTGGATTACCTCTTTTATTCATTCATTCAT
TTTCCTTCGACTTAGTGTTTATTTCAGAGGTCACCACTGCGGAATGAACTGCCAACTATTTCAGCATATG
TTTTATGCTGCAGATGCCTTTCCAACTGAAT