LncRNA Gene

ZFLNCG06517

Basic Information

Chromesome: chr10

Start: 41916835

End: 41917059

Transcript: ZFLNCT09984

Known as: ENSDARG00000092401

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR594771 endothelium normal 0.54
SRR1205172 5dpf transgenic sqET20 and neomycin treated 5h 0.31
SRR633516 larvae normal 0.15
SRR519727 6 dpf FETOH treatment 0.08
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
Zebrafish lncRNA Transcript Human lncRNA Transcript Mouse lncRNA Transcript Methods
ZFLNCT09984 ENST00000486251; NONHSAT125668; NONHSAT104458; NONHSAT024249; NONHSAT125667; ENSMUST00000117184; ENSMUST00000117794; ENSMUST00000172211; ENSMUST00000174168; ENSMUST00000173181; ENSMUST00000204790; ENSMUST00000172477; NONMMUT010656; NONMMUT029607; NONMMUT010657; NONMMUT029606; NONMMUT029605; NONMMUT009936; Collinearity with conserved coding gene
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06517
GGCGAGATCAGGAGACTCAATACTGCTTTCCTGCCAACTCATCATGTCACAGAAAAATACTCCACACATT
ATTATAACTTTGTTTTCTGCTTTAAATATGGTCAACATGAACTGTGTTTCTGAACCTGCTGGTGATCATC
TCCATCTCTCACTTCAAGATGCTTCACAATCCAAAAAATATGATTATTCGCTCTCTGGGTGTAACTGATT
TAATTGCTGGCCTT