LncRNA Gene

ZFLNCG06644

Basic Information

Chromesome: chr11

Start: 11180125

End: 11180417

Transcript: ZFLNCT10188

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1205160 5dpf transgenic sqET20 and GFP+ 46.97
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 34.69
SRR1205169 5dpf transgenic sqET20 and neomycin treated 5h and GFP+ 34.27
SRR535978 larvae normal 31.48
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 28.82
ERR023143 swim bladder normal 26.20
SRR700537 heart Gata4 morpholino 24.96
SRR516125 skin male and 3.5 year 24.64
SRR516128 skin male and 5 month 24.34
SRR700534 heart control morpholino 23.49
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC100331323 0.61
vasna 0.59
zgc:64130 0.59
im:7143453 0.58
tm9sf2 0.57
sft2d1 0.56
zcchc24 0.56
ophn1 0.55
gna12a 0.55
cmtm3 0.55
Gene Ontology Download
GO P value
GO:0060351 1.91e-04
GO:0006807 3.08e-04
GO:0040007 3.54e-04
GO:0060325 4.56e-04
GO:0034641 5.12e-04
GO:0048589 1.55e-03
GO:0040011 1.83e-03
GO:0006725 2.11e-03
GO:0046483 2.12e-03
GO:1901360 2.18e-03
GO:0044425 1.10e-04
GO:0016020 1.16e-04
GO:0031526 1.91e-04
GO:0016021 1.50e-03
GO:0031224 1.58e-03
GO:0045121 1.90e-03
GO:0098857 1.90e-03
GO:0098590 2.54e-03
GO:0044463 3.59e-03
GO:0033010 3.62e-03
GO:0003676 3.13e-03
GO:0034739 3.62e-03
GO:0042903 3.62e-03
GO:0005018 3.62e-03
GO:0003829 3.62e-03
GO:0046970 3.62e-03
GO:0005017 7.24e-03
GO:0046934 7.24e-03
GO:0000293 1.08e-02
GO:0005114 1.08e-02
KEGG Pathway Download
KO P value
ko01522 2.90e-05
ko04068 1.20e-04
ko05224 1.71e-03
ko05212 1.94e-03
ko05200 2.86e-03
ko05146 3.20e-03
ko00512 3.44e-03
ko04320 3.92e-03
ko04668 5.50e-03
ko04912 5.76e-03
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06644
AGAGTTCTCGTATTCAAAATAAGCCACCGCACACCAAAGCCAGGCAAAACAGCGTGGCCATGAAGGAACG
TTTACCTTGCACAGTCGGTGCCTTTATCAGTATTACAACCTTATTATTAGTACCGTTTTCGCTCCTTTGA
TATCTGAAACTGCTTTGATCTGAAGTGTGTTACTTATTTGTTCTTTTTAGGCACCTTACTTTTTTGTGCA
GTTCACAAATGTGAGTGGAGAACGTCGTTTTTAACCATCCAGTGTTTCTCTGAGCTCTTCAGAAAAAGCA
CACACACAAAAG