LncRNA Gene

ZFLNCG06700

Basic Information

Chromesome: chr11

Start: 12546272

End: 12546523

Transcript: ZFLNCT10262

Known as: ENSDARG00000091347

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR800037 egg normal 163.64
SRR800046 sphere stage 5azaCyD treatment 73.20
SRR800049 sphere stage control treatment 70.09
SRR800043 sphere stage normal 52.64
SRR800045 muscle normal 4.15
SRR658539 bud Gata5/6 morphant 4.03
SRR1039571 gastrointestinal diet 0.1 NPM 2.51
SRR1039573 gastrointestinal diet 0.75 NPM 1.78
SRR749514 24 hpf normal 1.50
SRR658543 6 somite Gata5 morphan 1.44
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06700
GTCTGCGTCTCTCTGTGTCGCTCAGGCTGAACTGCAGTGTCTATTCACAGGCACGATCCCACTACTGATC
GGCCGGTTCACTCCTCCTTTAACGACCTGGCGGTCCCAAGCTCACCCAGGAGCACCATATTGATACCGAA
CTTAGTGCGGGCACCCGATCGACATAGTCCACTGCAGTCCAGAAGCCCTGAGCTCAAGCGATCCGCAGCC
TCAGCCTCCCAGTCAGGGGCGGACTGGGACAAAAATTCGGC