LncRNA Gene

ZFLNCG06718

Basic Information

Chromesome: chr11

Start: 12743242

End: 12743529

Transcript: ZFLNCT10281

Known as: ENSDARG00000089408

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR800037 egg normal 548.73
SRR800046 sphere stage 5azaCyD treatment 414.68
SRR800049 sphere stage control treatment 313.30
SRR800043 sphere stage normal 307.37
SRR658539 bud Gata5/6 morphant 20.78
SRR800045 muscle normal 16.91
SRR658547 6 somite Gata5/6 morphant 14.34
SRR886456 256 cell 4-thio-UTP metabolic labeling 9.84
SRR1167763 embryo ptpn6 morpholino and bacterial infection 9.36
SRR886457 512 cell 4-thio-UTP metabolic labeling 3.18
Express in tissues
Correlated coding gene Download
gene correlation coefficent
zgc:195633 0.55
LOC100334621 0.52
zgc:113984 0.52
LOC100334933 0.51
zgc:173552 0.51
zgc:114037 0.50
LOC564732 0.50
Gene Ontology Download
GO P value
GO:0006342 5.18e-06
GO:0045814 6.99e-06
GO:0040029 1.06e-05
GO:0016458 2.86e-05
GO:0045892 5.17e-04
GO:1903507 5.22e-04
GO:1902679 5.22e-04
GO:0051253 5.56e-04
GO:0051673 6.39e-04
GO:0045934 6.84e-04
GO:0044427 2.83e-06
GO:0000790 1.41e-05
GO:0000786 2.24e-05
GO:0044815 2.73e-05
GO:0032993 3.41e-05
GO:0000785 3.70e-05
GO:0044454 1.43e-04
GO:0005694 1.65e-04
GO:0032991 3.13e-03
GO:0044446 3.15e-03
GO:0046982 1.46e-04
GO:0003677 6.26e-04
GO:0046983 1.41e-03
GO:0003676 3.69e-03
GO:1901363 2.03e-02
GO:0097159 2.09e-02
GO:0030246 2.12e-02
KEGG Pathway Download
KO P value
ko05322 1.55e-12
ko05034 3.93e-11
ko05202 1.48e-05
ko05203 6.82e-05
ko04217 4.82e-04
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06718
CCGAATTTTTGTCCCAGTCCGCCCCTGACTGGGAGGCTGAGGCTGCGGATCGCTTGAGCTCAGGGCTTCT
GGACTGCAGTGGACTATGTCGATCGGGTGTCCGCACTAAGTTCGGTATCGATATGGTGCTCCTGGGTGAG
CTCGGGACCGCCAGGTCGTTAAAGGAGGAGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAGCTCC
CGTGCTGATCAGTAGTGGGATCGCGCCTGTGAATAGACACTTCAGTTCAGCCTGAGCGACACAGAGAGAC
GCAGACT