LncRNA Gene

ZFLNCG06843

Basic Information

Chromesome: chr11

Start: 31207364

End: 31207671

Transcript: ZFLNCT10456

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023145 heart normal 350.90
ERR023143 swim bladder normal 163.68
ERR023146 head kidney normal 100.52
SRR1049946 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with DMSO 90.59
SRR1299125 caudal fin Half day time after treatment 59.40
SRR957181 heart normal 59.01
SRR957180 heart 7 days after heart tip amputation 54.30
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 50.22
SRR1299127 caudal fin Two days time after treatment 48.45
SRR1299129 caudal fin Seven days time after treatment 46.32
Express in tissues
Correlated coding gene Download
gene correlation coefficent
cflara 0.63
si:ch211-165d12.4 0.61
ftr79 0.61
LOC561108 0.59
cyba 0.58
crfb2 0.57
LOC100004321 0.57
gnai2a 0.57
stat1b 0.57
btr31 0.57
Gene Ontology Download
GO P value
GO:0002376 1.03e-03
GO:0002683 1.15e-03
GO:1902042 2.98e-03
GO:1902041 2.98e-03
GO:0060330 2.98e-03
GO:0060331 2.98e-03
GO:0060336 2.98e-03
GO:0060334 2.98e-03
GO:0002682 5.08e-03
GO:0045824 5.96e-03
GO:0043020 2.98e-03
GO:0008537 8.93e-03
GO:0042612 1.48e-02
GO:0044422 1.58e-02
GO:0044446 1.60e-02
GO:0005764 1.65e-02
GO:0000323 1.75e-02
GO:0072669 2.07e-02
GO:0005773 2.32e-02
GO:0019898 2.37e-02
GO:0004896 1.94e-04
GO:0019979 2.98e-03
GO:0003692 2.98e-03
GO:0003726 5.96e-03
GO:0004904 5.96e-03
GO:0004449 8.93e-03
GO:0005070 8.93e-03
GO:0042605 1.19e-02
GO:0097200 1.19e-02
GO:0061133 1.48e-02
KEGG Pathway Download
KO P value
ko04217 6.22e-07
ko05168 7.23e-07
ko05167 1.68e-05
ko04630 3.92e-05
ko04380 4.21e-05
ko04621 8.99e-05
ko05152 2.05e-04
ko04620 2.11e-04
ko05162 4.24e-04
ko05145 5.11e-04
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06843
CTCACTTCATGCTGCCAGGAGTGTTTTCAGATTTTTGGCTGTCCACACATTCAGTTCATTCATAAAGCTT
ATTAATCTGCTAATACACATCTTCCATCCTTCAATGACATTCTGCCACCTTGACTATTAATCGTTAGGAC
TCCAGTACAAAAGCAGGTTATAAAGTACAATGTGTTATTTTTTTAGATGTTGATAATTATAGACAATTAT
ACACAGTAACGTTTGAAACAGAAGGGGAAAGAGTAATTATAATTCCATTTATCAATCTGCTAATACACAT
CTTCCAGGACCTTCAATGACATTCTAG