LncRNA Gene

ZFLNCG06920

Basic Information

Chromesome: chr11

Start: 41610457

End: 41610696

Transcript: ZFLNCT10599

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023143 swim bladder normal 335.17
SRR592701 pineal gland normal 142.72
SRR1028002 head normal 133.50
SRR592703 pineal gland normal 113.59
SRR592702 pineal gland normal 106.57
SRR1028004 head normal 98.91
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 96.62
SRR516122 skin male and 3.5 year 78.67
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 78.39
SRR1205160 5dpf transgenic sqET20 and GFP+ 72.67
Express in tissues
Correlated coding gene Download
gene correlation coefficent
olfml3a 0.78
ctgfb 0.77
bicc1b 0.76
mxra8b 0.75
LOC796607 0.75
col8a2 0.74
ltbp1 0.74
LOC100150496 0.73
ccdc80 0.73
LOC100149853 0.72
Gene Ontology Download
GO P value
GO:0090304 1.89e-10
GO:0046483 2.02e-10
GO:0034641 2.26e-10
GO:0044237 2.67e-10
GO:0044260 2.73e-10
GO:0006807 3.16e-10
GO:0006139 3.52e-10
GO:0006725 8.32e-10
GO:1901360 1.06e-09
GO:0016070 4.62e-09
GO:0031012 4.79e-11
GO:0005576 4.90e-11
GO:0005578 5.81e-11
GO:0044421 6.65e-11
GO:0005581 1.18e-10
GO:0005615 1.23e-10
GO:0044422 2.83e-10
GO:0043226 3.04e-10
GO:0044446 3.09e-10
GO:0043229 3.29e-10
GO:0005201 2.37e-10
GO:1901363 1.26e-09
GO:0005520 1.66e-09
GO:0003676 1.66e-09
GO:0097159 1.94e-09
GO:0005539 6.99e-09
GO:0008201 4.02e-08
GO:0019838 5.59e-08
GO:0005102 4.90e-07
GO:0005126 3.82e-06
KEGG Pathway Download
KO P value
ko04974 1.59e-13
ko04512 1.89e-10
ko04060 6.01e-10
ko04510 2.31e-08
ko05146 3.42e-07
ko04933 1.20e-06
ko05200 1.74e-06
ko04151 7.80e-06
ko04350 6.79e-05
ko04610 1.01e-04
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06920
CTGAAATCATGTGCTTTGAGTTGCTTTTGCACTGTTTAGTTTAGCGCTGCTTTAAGCTCATAGCATATTT
ACACTTTTAGATGTACACGAGGGTCTGACACACAAAAATGAACTGCTTTTCAATCCTCTGGTGTCAACAC
TGAACCGGCCTGTTATTTCAGTTTTTGGAAAGAAACTAAGACTGAACAAAAGCAACACAAGACAACACTG
AAAATGGCAAAAATAGCCATTGACAAGTG