LncRNA Gene

ZFLNCG07005

Basic Information

Chromesome: chr12

Start: 572398

End: 572699

Transcript: ZFLNCT10708

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516134 skin male and 5 month 144.89
SRR372793 shield normal 109.67
SRR1647684 spleen SVCV treatment 104.83
SRR1299127 caudal fin Two days time after treatment 102.97
ERR023145 heart normal 102.83
SRR1647681 head kidney SVCV treatment 101.26
SRR1299125 caudal fin Half day time after treatment 97.93
SRR1299126 caudal fin One day time after treatment 90.56
SRR1299124 caudal fin Zero day time after treatment 89.01
ERR023143 swim bladder normal 87.57
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-9i23.15 0.59
gnpat 0.58
ccdc79 0.58
rnf181 0.58
snx5 0.58
tmem251 0.57
LOC566646 0.57
gga1 0.57
zgc:171959 0.57
LOC100332992 0.56
Gene Ontology Download
GO P value
GO:0070192 1.27e-06
GO:0007130 4.99e-05
GO:0070193 4.99e-05
GO:1903046 5.56e-05
GO:0044702 8.00e-05
GO:0022414 1.36e-04
GO:0051276 5.96e-04
GO:0015031 1.62e-03
GO:0045184 1.93e-03
GO:0044795 2.27e-03
GO:0000795 7.47e-05
GO:0044454 1.40e-03
GO:0070187 4.54e-03
GO:0070531 6.81e-03
GO:0000783 9.07e-03
GO:0000782 9.07e-03
GO:0032593 9.07e-03
GO:0044427 1.04e-02
GO:0016328 1.36e-02
GO:0055038 1.36e-02
GO:0017061 2.27e-03
GO:0004571 1.13e-02
GO:0004731 1.36e-02
GO:0003674 1.97e-02
GO:0052769 2.03e-02
GO:0008933 2.03e-02
GO:0052859 2.03e-02
GO:0052736 2.03e-02
GO:0044653 2.03e-02
GO:0044654 2.03e-02
KEGG Pathway Download
KO P value
ko00564 1.75e-02
ko04144 3.15e-02
ko00592 3.89e-02
ko00591 4.49e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG07005
TGCATTTATTTACTGACTTGAGCTCTATAAAATCAATAGAACAGTGAACAAACTGGCTGTGAATCAGTAG
AAACAGTGATAAAGGCAGAACTGAACAGTGTCACAGTGGTCTGACATCATTAATAAAACAACAACTGCAC
TATTTCAGATTAAATATTCTCATTTAACAGCTCATCAAGACTTAAGTAATTGATTACAGGTGAGTTTTAC
CATTTTTCAATCCACTCAGCCAATCTCAACGTCTGACGGAGCACTTTTAGCTTAGCTTAGCATAGATAAT
GGAATCGGATTAGACCATTAG