LncRNA Gene

ZFLNCG07202

Basic Information

Chromesome: chr12

Start: 26820405

End: 26820630

Transcript: ZFLNCT10980

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1647680 head kidney SVCV treatment 28.25
SRR516122 skin male and 3.5 year 26.78
SRR1647684 spleen SVCV treatment 23.01
SRR1647681 head kidney SVCV treatment 21.06
SRR1647683 spleen SVCV treatment 20.75
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 20.70
SRR516123 skin male and 3.5 year 20.70
SRR516124 skin male and 3.5 year 20.45
SRR891504 liver normal 19.32
SRR516128 skin male and 5 month 17.89
Express in tissues
Correlated coding gene Download
gene correlation coefficent
lyn 0.60
selplg 0.60
hcar1-4 0.59
LOC100334928 0.59
fgl2 0.58
tnfrsf1a 0.58
si:ch211-149p10.2 0.58
lifrb 0.58
lygl1 0.57
socs3a 0.57
Gene Ontology Download
GO P value
GO:0002682 6.98e-12
GO:0050776 1.88e-09
GO:0002376 1.96e-09
GO:0006955 2.52e-08
GO:0031347 4.73e-08
GO:0002683 1.60e-07
GO:0006952 3.91e-07
GO:0080134 4.61e-07
GO:0048583 5.93e-07
GO:0002684 9.25e-07
GO:0043228 4.43e-03
GO:0043232 4.43e-03
GO:0044422 7.23e-03
GO:0016021 7.73e-03
GO:0044446 9.91e-03
GO:0031224 1.05e-02
GO:0005764 1.53e-02
GO:0043514 1.57e-02
GO:0000323 1.65e-02
GO:0044421 1.69e-02
GO:0004896 1.62e-08
GO:0004888 7.74e-06
GO:0004872 8.02e-06
GO:0060089 8.02e-06
GO:0038023 1.17e-05
GO:0099600 1.57e-05
GO:0004871 4.33e-05
GO:0004904 6.17e-05
GO:0098772 8.20e-05
GO:0005031 1.29e-04
KEGG Pathway Download
KO P value
ko04064 5.08e-11
ko04620 1.42e-09
ko04380 2.61e-09
ko05160 1.20e-08
ko04060 1.53e-08
ko05167 1.53e-08
ko04621 1.60e-08
ko05164 3.21e-08
ko04668 1.25e-07
ko04217 5.93e-07
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG07202
TCTGATCCAAGCGTCTCCCCGGAGAGTCGTCAGTCTATAGCAATCGATGATTGGCTAAACAAGTGACATG
TCTTGTGTGTTCTATAGTCTTTAGATCCGCTCACTTTAAAATCTCTGGTGTCAACACCTATTTGCTGACA
AAATAAGCTGACTTTTATTATATAGACAAACAAAATGTCAAAATTATGGGAAGCTTTAGAAAGATGGATG
AGTTTTCAGTTCTAC