LncRNA Gene

ZFLNCG07361

Basic Information

Chromesome: chr12

Start: 46197566

End: 46197813

Transcript: ZFLNCT11278

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516129 skin male and 5 month 62.31
SRR516123 skin male and 3.5 year 61.85
SRR516133 skin male and 5 month 60.29
SRR516135 skin male and 5 month 54.48
SRR516125 skin male and 3.5 year 45.08
SRR941753 posterior pectoral fin normal 40.63
SRR941749 anterior pectoral fin normal 40.02
SRR516124 skin male and 3.5 year 39.66
SRR516132 skin male and 5 month 39.37
SRR516121 skin male and 3.5 year 38.43
Express in tissues
Correlated coding gene Download
gene correlation coefficent
zgc:153317 0.65
LOC101885287 0.65
LOC101884711 0.64
LOC100329837 0.64
psmb10 0.63
LOC100329767 0.63
psme2 0.63
si:dkey-222h21.9 0.63
LOC560422 0.63
psmb8 0.63
Gene Ontology Download
GO P value
GO:0019882 3.77e-12
GO:0002253 8.69e-12
GO:0050776 1.10e-11
GO:0002682 1.46e-11
GO:0002684 1.76e-11
GO:0043207 1.81e-11
GO:0002252 2.21e-11
GO:0051707 2.34e-11
GO:0050778 2.98e-11
GO:0009607 3.16e-11
GO:0044422 1.45e-10
GO:0044446 2.02e-10
GO:0044424 3.20e-10
GO:0042611 3.49e-10
GO:0043226 2.53e-08
GO:0043229 6.57e-08
GO:0042613 1.31e-06
GO:0043227 1.96e-06
GO:0043231 2.61e-06
GO:0044428 2.68e-06
GO:0004896 1.26e-07
GO:0001637 1.67e-05
GO:0004950 1.67e-05
GO:0004252 5.81e-05
GO:0003950 6.70e-05
GO:0004888 2.60e-04
GO:0008236 2.61e-04
GO:0017171 2.61e-04
GO:0004872 2.62e-04
GO:0060089 2.62e-04
KEGG Pathway Download
KO P value
ko04612 1.86e-12
ko05340 6.85e-12
ko05164 1.53e-11
ko05320 1.32e-10
ko04060 2.02e-10
ko05330 4.82e-10
ko05168 5.72e-10
ko05162 2.00e-09
ko05152 6.03e-09
ko05321 1.19e-08
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG07361
TTTCACCTCCCAATCCTGCCCCCTTGATCCTCAGCTTTTTGGTACAGTATGTAACACCCCCAAGTTGCCA
ACTTTGGTATAGTATCTGATGGCAGCGGCCGCCTGAAACCCCCGTAGTACAGTGACTAACCCAGTTCTCA
ACAGTGTTATTCAGACACCTCACTCCCGAACACCCTCAGACTTCTGGATTTTAGAGACAATGTTGGCAGG
TATCCACTATGCTGATACACAGGCATTTCTAGCTCCT