LncRNA Gene

ZFLNCG07549

Basic Information

Chromesome: chr13

Start: 15188460

End: 15188670

Transcript: ZFLNCT11546

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1048059 pineal gland light 101.21
SRR592700 pineal gland normal 44.32
SRR516130 skin male and 5 month 21.84
SRR1048061 pineal gland dark 16.76
SRR1188156 embryo Control PBS 4 hpi 16.58
SRR038626 embryo control morpholino and bacterial infection 14.94
SRR516127 skin male and 5 month 14.58
SRR941749 anterior pectoral fin normal 14.05
SRR726542 5 dpf infection with control 13.53
SRR941753 posterior pectoral fin normal 13.33
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-159f12.2 0.54
Gene Ontology Download
GO P value
GO:0006412 1.88e-02
GO:0043043 1.93e-02
GO:0043604 2.25e-02
GO:0006518 2.27e-02
GO:0043603 2.79e-02
GO:1901566 3.88e-02
GO:0005840 1.04e-02
GO:1990904 2.79e-02
GO:0030529 2.79e-02
GO:0005622 3.06e-02
GO:0003735 1.27e-02
GO:0005198 2.70e-02
KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG07549
CCACGAGTCAGCTCCACCTTTACTCCTCTGTCTCTCTCTGTCCAGCTGGCATCCTCTTCATACACAGCCG
TTTTTTCTGCTACTTTTCTCCGCTTTACAGCGTCTCAGTGCTGCAGCGGCTCTCGCGGTGCTTTCTGAAT
GCTTTTCGGGCTCTAAGATTGAATACAAACAGTGTGCTAAAGACTGCTAGGGGAAACTGGTTAACTTGAG