LncRNA Gene

ZFLNCG08143

Basic Information

Chromesome: chr14

Start: 34045607

End: 34045848

Transcript: ZFLNCT12500

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1048059 pineal gland light 79.39
SRR886456 256 cell 4-thio-UTP metabolic labeling 68.00
SRR516124 skin male and 3.5 year 40.56
SRR886457 512 cell 4-thio-UTP metabolic labeling 34.94
SRR886455 128 cell 4-thio-UTP metabolic labeling 33.55
SRR1648856 brain normal 26.11
SRR592701 pineal gland normal 26.01
SRR1021213 sphere stage normal 23.28
SRR1048061 pineal gland dark 21.99
SRR1021215 sphere stage Mzeomesa 19.74
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG08143
AGACACTTCAGTCTATTGCACTCACAAGTTAGGCCTCCAATAGGATGGACGGGAAACTCACAAACAGCAC
TAAAACTGAGTCTCCCGCTAAGCACTGATAGGTTGAATATTATTGATCCCCCCACAAATTTTACAGAAGC
GTTTACTCGTCGTCGTAAGGCAGTTTGGTGGTCTGCAGAGAGCCCAGTTACACCTCTCTACCCCCCATCT
TTAATACAGAGCAGCTAAAACCACAAGAAAG