LncRNA Gene

ZFLNCG08165

Basic Information

Chromesome: chr14

Start: 35952698

End: 35953066

Transcript: ZFLNCT12529

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR145631 skeletal muscle 32 degree_C to 16 degree_C 127.53
SRR516124 skin male and 3.5 year 112.34
ERR145635 skeletal muscle 27 degree_C to 16 degree_C 110.81
SRR891510 muscle normal 90.42
SRR1291417 5 dpi injected marinum 77.55
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 65.56
SRR516125 skin male and 3.5 year 64.16
SRR941749 anterior pectoral fin normal 62.68
SRR527833 5 dpf normal 62.12
SRR527834 head normal 59.12
Express in tissues
Correlated coding gene Download
gene correlation coefficent
tgfbr2 0.62
col5a2a 0.62
ehd2 0.59
lama4 0.59
elk3 0.59
fgf18a 0.59
slc16a12b 0.59
nfatc3b 0.58
prkag2b 0.58
gpr126 0.58
Gene Ontology Download
GO P value
GO:0007409 2.19e-04
GO:0032989 4.01e-04
GO:0044767 5.82e-04
GO:0048812 7.38e-04
GO:0032502 7.86e-04
GO:0030199 8.88e-04
GO:0030334 9.80e-04
GO:0016203 1.18e-03
GO:2000145 1.19e-03
GO:0043062 1.21e-03
GO:0031012 3.28e-11
GO:0044421 1.17e-08
GO:0005578 2.23e-08
GO:0005615 5.37e-06
GO:0005576 2.75e-04
GO:0005581 4.71e-04
GO:0044853 1.51e-03
GO:0005901 1.51e-03
GO:0044464 1.66e-03
GO:0044424 2.61e-03
GO:0004867 3.02e-04
GO:0005201 9.02e-04
GO:0004175 1.02e-03
GO:0097159 2.34e-03
GO:0004866 2.41e-03
GO:0070011 2.45e-03
GO:0061135 2.96e-03
GO:0008233 3.20e-03
GO:0030414 3.21e-03
GO:1901363 3.24e-03
KEGG Pathway Download
KO P value
ko04512 1.31e-06
ko04974 4.90e-06
ko04510 4.57e-05
ko04933 3.88e-04
ko05146 6.89e-04
ko04611 1.05e-03
ko04151 1.68e-03
ko05164 6.79e-03
ko04659 6.97e-03
ko04010 7.77e-03
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG08165
TTCACTTAGCCCTGGCGGCAGCCCTGGAAGATAAGGAAAGCCTCAGTACACTGTACATAATCTACATGAA
GCTTGCAGAGATTCATGCCAACTACATGCCAGATGCTGAACTATCTAAAAGCTACATGGACAGAGCGCAG
AGTCTGAGGAATGAACTGGCAGGATACACAGACTCAAAAGACACAGAAGAAACAGACGAGGCTGATGCTG
ACATTGACAACAAATCTGCTCATTCAGACGCCAGCAGTGGCACAAGCACCCTCACAGAGTCCAGCATGAT
CAATACCAGCCTTACAATCAATGCCCAGAAAGAGCCTGAGCACTCCAATGGAAGTCACAAAGACGATACA
AACACCAACAGATCAGAT