LncRNA Gene

ZFLNCG08332

Basic Information

Chromesome: chr15

Start: 2812213

End: 2812518

Transcript: ZFLNCT12818

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516122 skin male and 3.5 year 16.83
SRR1028004 head normal 9.93
SRR1205160 5dpf transgenic sqET20 and GFP+ 9.91
SRR941749 anterior pectoral fin normal 9.78
SRR941753 posterior pectoral fin normal 8.24
SRR516121 skin male and 3.5 year 7.85
SRR516126 skin male and 5 month 7.80
SRR516131 skin male and 5 month 7.34
SRR516128 skin male and 5 month 7.30
SRR1048059 pineal gland light 7.25
Express in tissues
Correlated coding gene Download
gene correlation coefficent
zgc:123305 0.50
Gene Ontology Download
GO P value
GO:0046463 5.69e-04
GO:0046460 5.69e-04
GO:0019432 5.69e-04
GO:0006641 1.14e-03
GO:0006639 1.28e-03
GO:0006638 1.28e-03
GO:0009062 1.56e-03
GO:0072329 2.06e-03
GO:0045017 2.98e-03
GO:0044242 3.55e-03
GO:0008195 2.84e-04
GO:0003713 4.41e-03
GO:0003712 9.38e-03
GO:0000989 1.07e-02
GO:0000988 1.08e-02
GO:0016791 1.39e-02
GO:0042578 2.04e-02
GO:0016788 3.40e-02
KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG08332
TAGTATTTTGGAGGCCAGTGTTGAACAATTACTCCGCACATCCTTACTTTCTTCTTTCTCTCAGCATGTA
ATCCATTACTTTATTGCACAGCTCTTTCTGTGGATTCTTCCTTTTTCTGTGTCACATTTTTGTTCCTCAC
ATTCTCACTCTTGCTTGCTTCTTTCTGAAGTGCTGTAGGAAAAGGTTATTTCCAGGGTTGGTTTGTTTCA
GATAAGGATCTCCACAAGATCTAGATCAAGCAAGGGCATCTTCTGTCCTGCAGTCAGCTGTGCTCGACCC
TCCAGGCCTTTAGATTGGCTGGATG