LncRNA Gene

ZFLNCG08500

Basic Information

Chromesome: chr15

Start: 22774915

End: 22775198

Transcript: ZFLNCT13078

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023144 brain normal 147.79
ERR023145 heart normal 111.31
ERR023143 swim bladder normal 109.07
ERR023146 head kidney normal 35.42
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 28.70
SRR1291417 5 dpi injected marinum 25.86
SRR1048059 pineal gland light 24.27
SRR1565805 brain normal 23.93
SRR1565813 brain normal 23.71
SRR1565809 brain normal 23.19
Express in tissues
Correlated coding gene Download
gene correlation coefficent
pcnp 0.60
dpm2 0.60
si:dkey-15j16.2 0.58
slc8a2a 0.58
setd7 0.57
tmem9 0.56
fundc1 0.56
dnajb9a 0.56
LOC100535549 0.55
LOC100537473 0.55
Gene Ontology Download
GO P value
GO:0065007 1.74e-03
GO:0045778 2.70e-03
GO:2000599 2.70e-03
GO:2000598 2.70e-03
GO:0030501 2.70e-03
GO:0032258 2.70e-03
GO:0033688 2.70e-03
GO:0070169 2.70e-03
GO:0045669 2.70e-03
GO:0033689 2.70e-03
GO:0033185 5.39e-03
GO:0034272 5.39e-03
GO:0034271 5.39e-03
GO:0035032 8.08e-03
GO:0000407 1.88e-02
GO:0031501 1.88e-02
GO:0033179 2.14e-02
GO:0031301 2.35e-02
GO:0031307 2.40e-02
GO:0031306 2.40e-02
GO:0042015 2.70e-03
GO:0098809 2.70e-03
GO:0046857 2.70e-03
GO:0008942 2.70e-03
GO:0018024 4.22e-03
GO:1901363 5.44e-03
GO:0097159 5.45e-03
GO:0042054 6.82e-03
GO:0004510 8.08e-03
GO:0016661 8.08e-03
KEGG Pathway Download
KO P value
ko00310 7.35e-03
ko04137 9.20e-03
ko04142 2.92e-02
ko04626 3.20e-02
ko00120 3.55e-02
ko00563 3.90e-02
ko05152 4.33e-02
ko04966 4.59e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG08500
TTGTGTTCTAGGACTGCACAATTTATCATTTCAGCATTAACATCGCAATGTGCGCATCTGCATAAGTCAC
ATAGCAAGAAATGCAATGTTGAGTCTGAATTATAGCTGATCAGGAGCCACAGAACACATGATTTGTAGAG
TCACTGCTGTTTAACCATAACAGAGTGAAAGTTTATCATTGGCGTGTGTTTTTAAGTCCTGTGACTGATT
ACTTCAAGAGAGTTTAAAACATTTGGGCATCAAAAAAATTATGTTTGATTTTTTTGTCTTGTTTCTAATC
CAA