LncRNA Gene

ZFLNCG08702

Basic Information

Chromesome: chr15

Start: 42236986

End: 42237346

Transcript: ZFLNCT13420

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1205160 5dpf transgenic sqET20 and GFP+ 136.37
SRR372802 5 dpf normal 105.89
SRR1205169 5dpf transgenic sqET20 and neomycin treated 5h and GFP+ 104.76
SRR065196 3 dpf normal 92.50
SRR726541 5 dpf infection with Mycobacterium marinum 90.45
SRR065197 3 dpf U1C knockout 86.62
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 81.27
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 80.65
SRR726542 5 dpf infection with control 74.50
SRR519732 7 dpf FETOH treatment 63.16
Express in tissues
Correlated coding gene Download
gene correlation coefficent
zgc:85932 0.88
si:ch211-243g18.2 0.76
LOC100538221 0.76
ugt1a7 0.76
pax9 0.76
LOC563583 0.75
and3 0.74
and4 0.74
s100a11 0.74
foxi3b 0.74
Gene Ontology Download
GO P value
GO:0006351 1.18e-10
GO:0097659 1.18e-10
GO:0032774 1.33e-10
GO:0007275 1.50e-10
GO:0009889 1.75e-10
GO:0043412 1.86e-10
GO:0044707 1.97e-10
GO:0019219 1.97e-10
GO:0048856 2.10e-10
GO:0051171 2.19e-10
GO:0005578 2.37e-11
GO:0031012 3.85e-11
GO:0044421 7.50e-11
GO:0005576 1.67e-10
GO:0044428 1.76e-10
GO:0044446 2.96e-10
GO:0044422 4.09e-10
GO:0005737 1.80e-09
GO:0044444 6.71e-09
GO:0005581 4.51e-08
GO:0005201 1.93e-11
GO:0003700 1.32e-10
GO:0001071 1.32e-10
GO:0043565 2.02e-10
GO:0003677 2.59e-10
GO:1901265 3.22e-10
GO:0000166 3.22e-10
GO:0003723 3.80e-10
GO:0005509 4.59e-10
GO:0003824 6.14e-10
KEGG Pathway Download
KO P value
ko04974 4.25e-12
ko04512 6.67e-10
ko04978 4.50e-05
ko04510 5.40e-05
ko04151 6.06e-05
ko04260 1.02e-04
ko04514 1.13e-04
ko00430 9.67e-04
ko05203 1.09e-03
ko00480 2.32e-03
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG08702
GTTATTGCGTGAGTCAGAGATGAACTCATTATCTTGTGATGATTGTGATTCATTTACTGTTGAGCTCATG
AATATGCATGAGTGTTTGTAACTCTTCTCTTGATTTGTAGTTCCTGCACATGACGTTGTACAACTGATCC
CGGAGCAGCGAGAAGCTCCACATCTGCTGTAACTGTAACTGCTGTATGTGTGTGTGCGTGTGGTCAGTGC
TGTAACACACGGACATGGCGAGGAGCAGCTACTGTAAATAACACACTGCACTGGGGAACACTGCAGGTTT
AGTGTACTGCAGACAGTGGACGGGTGATTGCTGAATAAACAGATATTTTAAAGAACATCAGCAAAATTGA
TGTAATATTT