LncRNA Gene

ZFLNCG08958

Basic Information

Chromesome: chr16

Start: 18887220

End: 18887461

Transcript: ZFLNCT13795

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1028002 head normal 5.05
SRR1342219 embryo marco morpholino and infection with Mycobacterium marinum 3.73
SRR1205172 5dpf transgenic sqET20 and neomycin treated 5h 3.00
SRR610740 3 dpf normal 1.60
SRR1188152 embryo Insulin 0.5 hpi 1.58
SRR1028003 head normal 1.45
SRR1708345 embryo SIBAS 1.42
SRR1291417 5 dpi injected marinum 1.42
SRR726540 5 dpf normal 1.41
SRR038626 embryo control morpholino and bacterial infection 1.25
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG08958
GATGTTCCCCTGTAATTTACTCACTGAACTTCAATGAAGAGGTTTTTACTAGTTTAAAATGTCAGTTTCT
TTTGGAGAACTGGGCTGTTGCTGTGAGACTGTAAAATCAGTTGGGACCAGACTGGAGATGGGACCTTGAC
TATGAGAGAATGACTATTTGAATAGTTTTAATGTCTAACTTGATTGGGAATGGGACCTATTCTTTGTAAA
ATAGTTAAAAATACTCAATCTTGAAGAAAAA