LncRNA Gene

ZFLNCG08963

Basic Information

Chromesome: chr16

Start: 19162667

End: 19162977

Transcript: ZFLNCT13801

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1562531 muscle normal 4.11
SRR1562529 intestine and pancreas normal 3.52
SRR891512 blood normal 2.94
SRR891495 heart normal 2.88
SRR1647682 spleen normal 2.62
SRR1562532 spleen normal 2.06
ERR023144 brain normal 1.91
SRR1562528 eye normal 1.59
SRR516122 skin male and 3.5 year 1.48
SRR1647681 head kidney SVCV treatment 1.44
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC101887143 0.61
rnaset2l 0.58
si:dkey-222h21.10 0.58
LOC100333951 0.57
si:ch211-214p13.9 0.56
LOC795887 0.56
LOC567656 0.56
LOC101885964 0.56
si:dkey-222h21.2 0.56
cd40 0.56
Gene Ontology Download
GO P value
GO:0002376 1.85e-11
GO:0002682 1.88e-11
GO:0002252 2.18e-11
GO:0006955 2.44e-11
GO:0006952 7.15e-09
GO:0002684 1.50e-08
GO:0002253 1.60e-08
GO:0019882 1.67e-08
GO:0043207 2.07e-08
GO:0009607 2.75e-08
GO:0009897 9.26e-07
GO:0098552 1.33e-06
GO:0042611 2.51e-06
GO:0044424 3.94e-06
GO:0043227 9.77e-06
GO:0043231 1.50e-05
GO:0043226 2.90e-05
GO:0042613 3.46e-05
GO:0043229 4.38e-05
GO:0005634 9.93e-05
GO:0042289 4.51e-05
GO:0042287 4.51e-05
GO:0004888 7.49e-05
GO:0004896 1.21e-04
GO:0099600 1.33e-04
GO:0038023 3.05e-04
GO:0004872 4.79e-04
GO:0060089 4.79e-04
GO:0003674 6.38e-04
GO:0001637 1.23e-03
KEGG Pathway Download
KO P value
ko05330 6.14e-12
ko04612 3.07e-10
ko05310 2.16e-09
ko05340 2.34e-09
ko04650 3.12e-09
ko05332 3.23e-09
ko05320 7.72e-08
ko04940 1.45e-07
ko04660 4.44e-07
ko05144 1.20e-06
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG08963
GAAGAGCAACTCTTTATCCAGTCAGTGCACAGAGGAAGAAAAGGTCCCAATGCCAGTGCAGGAGATGTGT
GGGAAGACCGAGAAACTGGAGGATGTCTGAGAGAGGAGAAAGAAGACCACTGGTGCGTCTGAGTATTGAG
TATTTACTCTAGTACAAACCTGCTGCTGCCATTTACTCTGCACTGAGGTGGATCATCCAGATTGTTACGA
GAGAACAGAATGACGGTCCATCCTGAGAAATGCTGAGACGGAGAGAGATTTGAGCTCCCACTTCACATAA
AGACAAACACAACTTTTCACATACAGCTCA