LncRNA Gene

ZFLNCG09310

Basic Information

Chromesome: chr16

Start: 49570906

End: 49571321

Transcript: ZFLNCT14323

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023143 swim bladder normal 181.43
SRR1299127 caudal fin Two days time after treatment 85.79
SRR1299126 caudal fin One day time after treatment 77.77
ERR023146 head kidney normal 73.25
SRR1299129 caudal fin Seven days time after treatment 72.60
SRR1299124 caudal fin Zero day time after treatment 66.18
SRR1299125 caudal fin Half day time after treatment 63.39
ERR023145 heart normal 54.30
SRR516125 skin male and 3.5 year 46.07
SRR516123 skin male and 3.5 year 44.28
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:ch1073-443f11.2 0.70
micu2 0.69
serpinb1l2 0.68
tec 0.68
s100u 0.67
si:dkey-193b15.5 0.66
pik3cb 0.66
scamp2 0.66
emd 0.65
arpc4l 0.65
Gene Ontology Download
GO P value
GO:1901360 1.93e-08
GO:0044237 1.99e-08
GO:0044260 3.61e-08
GO:0046483 4.15e-08
GO:0006725 4.16e-08
GO:0006139 1.41e-07
GO:0034641 3.92e-07
GO:0090304 7.63e-07
GO:0051171 2.68e-06
GO:0009987 3.59e-06
GO:0043227 1.48e-05
GO:0005634 1.49e-05
GO:0043231 2.01e-05
GO:0043226 3.82e-05
GO:0016020 4.98e-05
GO:0043229 6.89e-05
GO:0005622 1.19e-04
GO:0044424 1.35e-04
GO:0005834 9.49e-04
GO:0044425 1.04e-03
GO:0003676 1.66e-09
GO:0004896 2.23e-05
GO:0032090 2.35e-04
GO:0004904 2.35e-04
GO:0003677 3.05e-04
GO:0097159 3.91e-04
GO:1901363 5.10e-04
GO:0005525 5.23e-04
GO:0003723 6.45e-04
GO:0032561 7.49e-04
KEGG Pathway Download
KO P value
ko04217 1.75e-08
ko05131 1.57e-07
ko04621 2.10e-07
ko05152 9.36e-06
ko04060 1.16e-05
ko04210 3.57e-05
ko04215 4.16e-05
ko05132 5.84e-05
ko05100 6.28e-05
ko04657 1.89e-04
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG09310
ACATAATTTACAATTGTTTTTGCTTGTACTACAGGGCTGCTGTATTCTTTATTCTGATTAGCTGATGAAT
ATTCTAGGTGTGCAATTATTTTGAAATAGATGCACAGCTAAAGTAGTTCTAAGCAGATTGTGACCGCTTT
ACAGTTCCATATCACTACGCCGAATGATTTCAGTTATTTTATATCCTACAACTGTTAAAAATTAATCAGA
ACATAAGGATTTGCAGGAGATAATGACCAAGATGGCTTGTGTGATGATTTGGGTAATTTCCGATGCAGAA
ACTATTCAGCTAGTTATATTGGTGCCATAAACATAGATGAATCAAACCCGCCAGGATTTTTAGAGGGGGT
TTAAATCAGAGCACATTTATTGCTGACATGAAAAATACAATCTAGATATTGTTTAATAAACAAAC