LncRNA Gene

ZFLNCG09439

Basic Information

Chromesome: chr17

Start: 7283783

End: 7284055

Transcript: ZFLNCT14516

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1039571 gastrointestinal diet 0.1 NPM 54.70
SRR1039573 gastrointestinal diet 0.75 NPM 38.86
SRR941753 posterior pectoral fin normal 28.99
SRR1562529 intestine and pancreas normal 25.03
SRR941749 anterior pectoral fin normal 15.60
SRR891512 blood normal 13.94
SRR1299124 caudal fin Zero day time after treatment 10.03
SRR1205160 5dpf transgenic sqET20 and GFP+ 8.09
SRR592702 pineal gland normal 6.45
SRR516124 skin male and 3.5 year 6.22
Express in tissues
Correlated coding gene Download
gene correlation coefficent
zgc:136902 0.53
cmah 0.51
crfb8 0.50
acp5b 0.50
Gene Ontology Download
GO P value
GO:0046381 1.42e-04
GO:0006054 4.26e-04
GO:0009225 2.56e-03
GO:0006040 2.56e-03
GO:0009612 4.68e-03
GO:0009628 2.79e-02
GO:0009605 3.45e-02
GO:1901135 4.79e-02
GO:0030338 1.42e-04
GO:0016716 5.68e-04
GO:0003993 1.28e-03
GO:0051537 2.70e-03
GO:0051540 6.24e-03
GO:0051536 6.24e-03
GO:0004497 1.59e-02
GO:0016705 2.05e-02
GO:0016791 2.75e-02
GO:0042578 4.04e-02
KEGG Pathway Download
KO P value
ko00740 3.33e-03
ko00520 2.27e-02
ko05323 3.66e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG09439
TGTTTTATTCGGTGTAAGTAACCTGTGTGTCTTTGTTGTTACACTCTGAAGCTTTTGAATTGCACAAGAG
AGACACTGAAACATCAGGGAAAACTCCAAATGCAGCACAGAGTGGTTCAGTAAATGTGGTGTTGAATGTG
TGTAAGAGCTTGAGTGTGTGCGTGTCAGAGACGCTGTAGAAGGACAGAGTGCCGGCAGACCGGTCCAGAT
ACACTCCTACTCTGTTAGAGTCAGATTTTGAATATTTATCTATATCTCTATTCGTATTTTTG