LncRNA Gene

ZFLNCG09496

Basic Information

Chromesome: chr17

Start: 14875444

End: 14875704

Transcript: ZFLNCT14614

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR726541 5 dpf infection with Mycobacterium marinum 11.09
SRR038626 embryo control morpholino and bacterial infection 10.95
SRR941749 anterior pectoral fin normal 10.15
SRR527834 head normal 9.71
SRR065197 3 dpf U1C knockout 9.17
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 6.97
SRR957181 heart normal 6.39
SRR594769 blood normal 6.32
SRR941753 posterior pectoral fin normal 6.01
SRR1188156 embryo Control PBS 4 hpi 5.55
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-159f12.2 0.58
crfb9 0.56
zgc:64065 0.55
nr5a1a 0.54
zgc:171551 0.54
si:dkey-20i20.2 0.53
LOC101883108 0.52
zgc:136804 0.52
zgc:113176 0.51
v-fbpl 0.51
Gene Ontology Download
GO P value
GO:0030325 4.47e-03
GO:0021854 4.96e-03
GO:0031018 1.24e-02
GO:0043401 3.72e-02
GO:0009755 4.06e-02
GO:0090575 1.73e-02
GO:0005622 1.77e-02
GO:0044798 2.02e-02
GO:0003676 1.35e-02
GO:0046872 2.27e-02
GO:0043169 2.44e-02
GO:0004879 2.46e-02
GO:0098531 2.46e-02
GO:0008081 3.33e-02
GO:0003707 3.82e-02
KEGG Pathway Download
KO P value
ko00531 6.37e-03
ko04630 3.63e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG09496
ACGATCTGCTCCCCAACTCCGTTCTCTATTTTTGTGCTTCCTTGTGCTGCCAAGCCCCTGACGTAATGCT
CCGTGTTAATTATTAGCATGTGGGAAGCGATGCCGAGACTCTCCTCTGCTGCTTAAACAAGAGCGACTGA
CTGCGGGGAGGAAAACCTCGTCAAGATGGCCAAACACTCTGACCCAGAGTGAAGGGGCACCGCTGCTCCC
TGTCCCGTCCCGTCCAGTCCTGTCCTACGACCATCACCAATGCAACTGCG