LncRNA Gene

ZFLNCG09505

Basic Information

Chromesome: chr17

Start: 15286195

End: 15286432

Transcript: ZFLNCT14643

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR800045 muscle normal 14.83
SRR891495 heart normal 9.36
SRR516122 skin male and 3.5 year 8.24
SRR372802 5 dpf normal 4.61
SRR942767 embryo myd88-/- and infection with Mycobacterium marinum 3.08
SRR372800 2 dpf normal 2.57
SRR1708343 embryo MUTAS 2.57
SRR535847 larvae normal 2.53
ERR145648 skeletal muscle 27 degree_C to 27 degree_C 2.35
SRR1188156 embryo Control PBS 4 hpi 2.10
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG09505
GTACGAAAGGTTTACATTTAAATTTGCTCTTACACAAAAATGACAAAATGAGGAGAAAGGTAACACAAAT
GCCTATTGCAGTAATGCCACCTACTGGACATAGTGGATGTTGACACAAAAGCCTGGGTTGTACTGAAATA
ATTCCTCAAAATGACCTGACCTAAAAAGGAAAGACAAATAAATGTTAGTAAAAACAATGTCAATCACATA
AAAACTAAATAAGCAATTCTGTAAATG