LncRNA Gene

ZFLNCG09724

Basic Information

Chromesome: chr17

Start: 39911143

End: 39911442

Transcript: ZFLNCT14972

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR800037 egg normal 41.49
SRR800043 sphere stage normal 32.69
SRR800049 sphere stage control treatment 30.05
SRR1021215 sphere stage Mzeomesa 15.54
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 15.19
SRR1021213 sphere stage normal 15.01
SRR800046 sphere stage 5azaCyD treatment 14.81
SRR1562533 testis normal 12.09
SRR1035984 13 hpf normal 11.31
SRR527835 tail normal 11.01
Express in tissues
Correlated coding gene Download
gene correlation coefficent
lamtor1 0.52
galnt6 0.52
rapgef5b 0.52
zgc:100911 0.51
LOC100148757 0.50
rnf152 0.50
Gene Ontology Download
GO P value
GO:0032006 1.21e-05
GO:0032439 3.55e-04
GO:1904262 3.55e-04
GO:1903432 3.55e-04
GO:0034198 1.42e-03
GO:0032008 1.42e-03
GO:0070936 1.78e-03
GO:0001919 1.78e-03
GO:0010508 2.49e-03
GO:0042632 2.49e-03
GO:0098588 2.96e-04
GO:0031090 7.27e-04
GO:0098805 1.32e-03
GO:0071986 1.78e-03
GO:0031902 4.26e-03
GO:0045121 6.38e-03
GO:0098857 6.38e-03
GO:0005765 9.21e-03
GO:0098852 9.21e-03
GO:0005774 1.41e-02
GO:0008755 7.09e-03
GO:0052824 7.09e-03
GO:0080062 7.09e-03
GO:0033931 7.09e-03
GO:0019112 7.09e-03
GO:0052639 7.09e-03
GO:0052638 7.09e-03
GO:0035496 7.09e-03
GO:0018718 7.09e-03
GO:0018715 7.09e-03
KEGG Pathway Download
KO P value
ko04150 1.91e-03
ko00512 1.20e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG09724
GCGTGTCCTCAAATCTGCCTCTGAAACACAATGGGATCACAATCACTGCCTCCTTTGGGACAGCAGAGAA
CAAACTACACAGACGACAACAACAGAATTTAGGTCATTACAGAGGCATATCGACTCCTGCTGAATCAGCT
GCAGCTTAAAAGAACAAATAGATGTAGACAGAAGAGTAACGGGCCCTGAGGTTTGACTGCATTACGTTGT
TGTGTGTAATGGGAGAGTGTGTGTTGGACCGCTATGAAGAAGATGGGTTTCAGAGTTGTGAAGGGTTTGA
CAACTGGGCCTCATTTAGC