LncRNA Gene

ZFLNCG10135

Basic Information

Chromesome: chr18

Start: 33543269

End: 33543469

Transcript: ZFLNCT15641

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1648854 brain normal 2834.98
SRR1648856 brain normal 1474.18
SRR1648855 brain normal 782.39
SRR941749 anterior pectoral fin normal 360.01
SRR1523211 embryo control morpholino 272.70
SRR1291417 5 dpi injected marinum 265.99
SRR1205160 5dpf transgenic sqET20 and GFP+ 262.44
SRR941753 posterior pectoral fin normal 231.79
SRR1205154 5dpf transgenic sqET20 211.89
SRR1291414 5 dpi normal 191.56
Express in tissues
Correlated coding gene Download
gene correlation coefficent
kdm2ba 0.61
robo1 0.60
dmbx1a 0.59
spon2a 0.59
kctd15a 0.59
kmt2e 0.58
ldb2b 0.57
sox1a 0.57
si:dkey-166k12.1 0.57
sox1b 0.57
Gene Ontology Download
GO P value
GO:0051171 2.75e-11
GO:0019219 4.60e-11
GO:2000112 5.52e-11
GO:0010556 6.51e-11
GO:0006355 7.15e-11
GO:1903506 7.27e-11
GO:2001141 7.52e-11
GO:0010468 1.06e-10
GO:0031326 1.09e-10
GO:0009889 1.18e-10
GO:0005634 3.17e-08
GO:0044444 1.94e-04
GO:0043231 2.88e-04
GO:0043227 2.99e-04
GO:0044425 1.28e-03
GO:0044446 1.39e-03
GO:0044422 1.40e-03
GO:0016021 2.34e-03
GO:0043229 2.71e-03
GO:0005667 2.89e-03
GO:0043565 1.95e-11
GO:0003676 6.19e-11
GO:0003677 1.13e-10
GO:0003824 3.59e-09
GO:1901363 7.96e-06
GO:0097159 9.31e-06
GO:0001071 4.15e-05
GO:0003700 4.15e-05
GO:0001012 9.17e-05
GO:0000977 9.17e-05
KEGG Pathway Download
KO P value
ko04550 3.56e-03
ko04530 8.79e-03
ko04015 1.51e-02
ko05224 4.36e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG10135
AAAAATCAGAGGATAACTGAGTATCTGCTGAAGTGTTTCCAGAAACGCTGCAGACATCTGAGGCTGAGAA
TAAATAACATTCAACTTTCGAATTCTAGTAGTGAGGAAATGTCACAATTATTTCTAATTTCACTAGATTT
CCAGCATTCACTGAGCTCCTGAGAGCTTCCCATTCTTTCACAAATGTTTGAAGATTTTCT