LncRNA Gene

ZFLNCG10450

Basic Information

Chromesome: chr19

Start: 16832826

End: 16833087

Transcript: ZFLNCT16174

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023143 swim bladder normal 1265.47
SRR1299126 caudal fin One day time after treatment 695.03
SRR1299129 caudal fin Seven days time after treatment 576.65
SRR1299127 caudal fin Two days time after treatment 536.00
SRR1299125 caudal fin Half day time after treatment 513.33
SRR527834 head normal 270.14
ERR023146 head kidney normal 265.10
ERR023145 heart normal 254.83
SRR516131 skin male and 5 month 216.29
SRR1299124 caudal fin Zero day time after treatment 202.23
Express in tissues
Correlated coding gene Download
gene correlation coefficent
crabp2a 0.52
Gene Ontology Download
GO P value
GO:0048385 7.82e-04
GO:0021575 7.82e-04
GO:0009966 4.36e-02
GO:0010646 4.71e-02
GO:0023051 4.72e-02
GO:0008289 1.66e-02
KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG10450
ACCAGTTTATTGCTCTCATATTGAAATGGCAGCACACATTATAATGGCAACTTAAACAGATAATTTGTTA
AAACAGGGCAAAGACCTTATCATTGCTTTGCAGACAGTTGTAAACATAAGCCTTCATTCCTCTTGATGTA
GTTTACACAGATTTATGCCAGTGAAGGATAAAAAATTATTTAAAGTTGAAAAAAAAGCTATACACCTAAA
ATACCATGCATGAAATCCCCAATACTTAAACTAAACGATTTCCTAAACACA