LncRNA Gene

ZFLNCG10489

Basic Information

Chromesome: chr19

Start: 20126973

End: 20127238

Transcript: ZFLNCT16239

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1004789 larvae impdh2 morpholino 10.57
SRR1049946 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with DMSO 10.54
SRR1647682 spleen normal 7.55
SRR1299126 caudal fin One day time after treatment 7.51
SRR1205154 5dpf transgenic sqET20 7.08
SRR516127 skin male and 5 month 6.87
SRR1647684 spleen SVCV treatment 6.74
SRR592701 pineal gland normal 6.66
SRR1035981 13 hpf rx3+/+ or rx3+/- 6.66
SRR516126 skin male and 5 month 6.46
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-20i20.2 0.52
si:dkey-159f12.2 0.51
zgc:171551 0.51
Gene Ontology Download
GO P value
GO:0005840 3.10e-02
GO:0003735 3.77e-02
KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG10489
AGGTACCATATAGGTAGATCAGCTCAGCGGCTCCATAATACCATAACAACAAAGTGGGATTGAAGTCGAG
CTGGCTTCATGTCACCTAAAACCCAAGAATGGTGCAAACTAAACCAAAACTTGACTGGCTAGCCAGCTAA
TCCAGCTTCATTATATGGCCTCAAGGCTTACTTGCACTGAAAATATTTAGCAGTCACAATTTTTAATACT
AATGTAATTCTCTTTTATGACCAAAAATCTAGTTTTGTATATCATGAAATGGCTT