LncRNA Gene

ZFLNCG10562

Basic Information

Chromesome: chr19

Start: 25358095

End: 25358345

Transcript: ZFLNCT16332

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1205160 5dpf transgenic sqET20 and GFP+ 24.13
SRR1205169 5dpf transgenic sqET20 and neomycin treated 5h and GFP+ 16.35
SRR891512 blood normal 13.32
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 13.02
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 12.81
SRR941753 posterior pectoral fin normal 11.47
SRR516121 skin male and 3.5 year 9.57
SRR800045 muscle normal 8.39
SRR726542 5 dpf infection with control 7.89
SRR1534351 larvae 500 ug/l BDE47 treatment 5.65
Express in tissues
Correlated coding gene Download
gene correlation coefficent
s100s 0.51
cga 0.51
LOC100330703 0.51
LOC101883885 0.50
Gene Ontology Download
GO P value
GO:0008150 3.25e-02
GO:0005179 1.11e-02
KEGG Pathway Download
KO P value
ko05320 4.02e-03
ko04913 8.74e-03
ko04923 1.07e-02
ko04918 1.19e-02
ko04917 1.21e-02
ko04912 1.69e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG10562
CGAGAGATACTTAACGAAGAGTGATGAGGCCAATAATTTGCTGATGTTGGAAACTGAGGAGATGAGACTG
CCGCTAACAATACTGCAGCACTAGAGATTTAGACACACACCTACACACACCCACATGCAATTGCACAGGC
AAAGAAATGATGCAAAATGATGATCTGCTGAGGATACGGCGGTAAATTTCTGTTCGGCTTTTAAAAGGAT
TTCTAGTGCTGATAGAAGAAGGATCCCGTTTGGATTGAGG