LncRNA Gene

ZFLNCG11958

Basic Information

Chromesome: chr22

Start: 6411718

End: 6412034

Transcript: ZFLNCT18498

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023145 heart normal 1978.53
ERR023143 swim bladder normal 724.93
ERR023146 head kidney normal 217.14
ERR145631 skeletal muscle 32 degree_C to 16 degree_C 114.01
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 112.77
ERR145648 skeletal muscle 27 degree_C to 27 degree_C 107.97
ERR145635 skeletal muscle 27 degree_C to 16 degree_C 97.24
SRR1299125 caudal fin Half day time after treatment 81.89
ERR023144 brain normal 81.86
SRR1299127 caudal fin Two days time after treatment 76.97
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC100535756 0.54
LOC101883120 0.54
LOC100004104 0.52
cmc1 0.52
lysmd4 0.51
zbtb8os 0.51
LOC100538148 0.51
rnaseka 0.51
dnajc19 0.50
zgc:194312 0.50
Gene Ontology Download
GO P value
GO:0006388 3.48e-03
GO:0000394 3.97e-03
GO:0009303 4.47e-03
GO:0034660 4.81e-03
GO:0098781 5.46e-03
GO:0006826 7.93e-03
GO:0006879 9.42e-03
GO:0046916 1.14e-02
GO:0055072 1.34e-02
GO:0055076 1.63e-02
GO:0072669 3.48e-03
GO:0005739 1.03e-02
GO:0005743 4.78e-02
GO:0008199 5.96e-03
GO:0043765 1.09e-02
GO:0044824 1.09e-02
GO:0004521 1.24e-02
GO:0004540 1.97e-02
GO:0004520 2.07e-02
GO:0004536 2.56e-02
GO:0004519 3.82e-02
KEGG Pathway Download
KO P value
ko04212 1.21e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG11958
CACAATTGGCAGTCACAAAAACAAACGAAAAGACTGAGGAACACAAATGACAATACAATTGAGTGCATAT
ACATAAACGTATGCTGAATTATTCTGTATTTAAAACACAAAAACTGCTTTATTTTCCATAGATTCTGCCA
ATTTTCATCTTAGATGTACAGTATTTGTGACCATGGTCTTTGTAGTGACCACAAGCGTACATTAATCATA
TCAGATTTATGTATCATCTAGAAGCATTTTTGGCTTGATTGATGGTTTGATAGGGTGGGATATTTGGCAG
AGCTACAACAGTTTGAAAATATTTATCAAAAAATTA