LncRNA Gene

ZFLNCG11978

Basic Information

Chromesome: chr22

Start: 7557773

End: 7558020

Transcript: ZFLNCT18528

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR592703 pineal gland normal 57.54
SRR516129 skin male and 5 month 42.84
SRR516125 skin male and 3.5 year 29.48
SRR1205160 5dpf transgenic sqET20 and GFP+ 26.80
SRR1299124 caudal fin Zero day time after treatment 26.33
SRR592701 pineal gland normal 24.53
SRR658539 bud Gata5/6 morphant 24.38
SRR658545 6 somite Gata6 morphant 23.85
SRR516122 skin male and 3.5 year 23.21
SRR1205151 5dpf transgenic sqET20 and neomycin treated 1h 20.48
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC100006875 0.57
LOC101884030 0.51
Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG11978
TCCCGTATGTGACCACGTGGTCCTTATCTTTCCAATTAGCTTTAAGATGAACATCTGTTAGGGGTAAGGG
GCATGGGCTGTGTGATATATGACTGGAAAGCAGCAGGATGGTTTTCACACCTGTTGTAGTATGTGTGGTT
TAGATTGAACTAGAATTGACCTCGTAAGCAGTACAACCCAGATAAAAGGATGAGCACACTTTGCTTCATT
GTCTCACTCTGCAGAAACTGTTGTTGCTGTATGACTG