LncRNA Gene

ZFLNCG12155

Basic Information

Chromesome: chr22

Start: 22533097

End: 22533365

Transcript: ZFLNCT18772

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1648856 brain normal 183.51
ERR023143 swim bladder normal 146.51
ERR023144 brain normal 145.15
SRR372802 5 dpf normal 143.84
ERR023146 head kidney normal 135.12
SRR886457 512 cell 4-thio-UTP metabolic labeling 127.49
SRR700534 heart control morpholino 122.14
SRR886456 256 cell 4-thio-UTP metabolic labeling 114.10
SRR1299125 caudal fin Half day time after treatment 107.61
SRR886455 128 cell 4-thio-UTP metabolic labeling 104.16
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG12155
TTCTTTGAGCTCATTTATTCATCTTAAAACATTATATTACATCATACAGTCGGAAAATACATATGAAGGA
GTTGGACAGTACCTTCAAACGAAGAGCAATGAGAGTATATTTAATGATAAAGCCAAATCCAGCAATATCT
GCACTATAACTTTGCCAGAGGGAAAACCTTATTAGATTAGCTGGGCCACTTCACTTAAATCACATTTAAC
AGCTATGTATTCATGTCTATGCGGACCCCCTAAATCCCCCCAAACCCCCTATATTTAT