LncRNA Gene

ZFLNCG12579

Basic Information

Chromesome: chr23

Start: 24418965

End: 24419286

Transcript: ZFLNCT19428

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1104058 heart normal 50.63
SRR1648856 brain normal 36.18
SRR1205151 5dpf transgenic sqET20 and neomycin treated 1h 32.39
SRR535978 larvae normal 32.10
ERR594418 retina transgenic flk1 and develop tumors 29.54
ERR023146 head kidney normal 29.22
SRR1205172 5dpf transgenic sqET20 and neomycin treated 5h 29.11
SRR1205166 5dpf transgenic sqET20 and neomycin treated 3h 28.46
SRR1205154 5dpf transgenic sqET20 27.25
SRR1647679 head kidney normal 24.73
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC101883939 0.84
fam177a1 0.65
samsn1a 0.65
si:ch211-212d10.2 0.63
ppp1r18 0.62
LOC101882370 0.61
rom1b 0.61
bada 0.60
parp8 0.60
LOC100005846 0.59
Gene Ontology Download
GO P value
GO:0007165 1.05e-04
GO:0043401 6.12e-04
GO:0009755 8.53e-04
GO:0050794 2.77e-03
GO:0050789 4.81e-03
GO:0090134 5.12e-03
GO:0043086 7.17e-03
GO:0010466 7.18e-03
GO:0007264 7.40e-03
GO:0065007 7.93e-03
GO:0005575 2.43e-02
GO:0032991 2.82e-02
GO:0044425 4.01e-02
GO:0005634 4.24e-02
GO:0016020 4.25e-02
GO:0031307 4.51e-02
GO:0031306 4.51e-02
GO:0003707 6.75e-04
GO:0004879 2.12e-03
GO:0098531 2.12e-03
GO:0004869 4.17e-03
GO:0098809 5.12e-03
GO:0031704 5.12e-03
GO:0046857 5.12e-03
GO:0008942 5.12e-03
GO:0098772 5.98e-03
GO:0008047 9.70e-03
KEGG Pathway Download
KO P value
ko05131 9.67e-03
ko04060 1.91e-02
ko04630 3.40e-02
ko05321 3.66e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG12579
GAGGTTTTGGGTAACTAATCTTTTTCACTGGTTTCCCATGCTCTCTGTCCAACCCATGTCTTTATTTATG
GACATGCCACTTCCTGCAGGGTAGAAGCTAGTAATTATGCACATGAAAGTTCACAGACAGAGTAAGTGGT
AAGTTTAAACCCAGATTTAGGGCCTGTCCCAGTTCTTACACTTTCAGTCTGTCCCAGGTCTAAAAACAGC
AAATTCAGTGCCCTTAACACACACTAAATTAATCCACAAACTCTAATATTGCTTTAGGGCAGTATTTGAG
GCTATTTAAAAAGTATTTCATCCATCGTCATGTTTGGGGAG